chapter 10 nucleic acids protein synthesis n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Chapter 10 Nucleic Acids & Protein Synthesis PowerPoint Presentation
Download Presentation
Chapter 10 Nucleic Acids & Protein Synthesis

Loading in 2 Seconds...

play fullscreen
1 / 23

Chapter 10 Nucleic Acids & Protein Synthesis - PowerPoint PPT Presentation


  • 110 Views
  • Uploaded on

Chapter 10 Nucleic Acids & Protein Synthesis. Overview Living organisms are constructed from thousands of different proteins. Each protein is constructed by ribosomes according to instructions held in the DNA of every cell. Remember: Structure of DNA. DNA is a double helix

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Chapter 10 Nucleic Acids & Protein Synthesis' - aiko


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
chapter 10 nucleic acids protein synthesis

Chapter 10Nucleic Acids & Protein Synthesis

Overview

Living organisms are constructed from thousands of different proteins. Each protein is constructed by ribosomes according to instructions held in the DNA of every cell.

remember structure of dna
Remember: Structure of DNA
  • DNA is a double helix
  • It is made of nucleotides.
  • There are four different types of nucleotides in DNA, each containing a different one of these nitrogen bases
    • Adenine (A)
    • Guanine (G)
    • Thymine (T)
    • Cytosine (C
structure of rna
Structure of RNA
  • RNA is a single helix, (although it can twist back on itself)
  • It is also made of nucleotides, but the four nitrogen bases in RNA are:
    • Adenine (A)
    • Guanine (G)
    • Uracil (U)
    • Cytosine (C)
types of rna
Types of RNA
  • Messenger RNA
    • The type of RNA that carries the genetic protein blueprint from the nucleus to the ribosomes
  • Transfer RNA
    • The type of RNA that bonds to amino acid and helps carry them to the ribosome and assemble them in the correct order.
  • Ribosomal RNA
    • Structural material that makes up the ribosomes. Stored in the nucleolus of animal cells
replication
Replication
  • DNA molecules can copy their entire structure, ie. Make new copies of themselves
  • All the information stored in the DNA is copied
protein synthesis the four t s
Protein Synthesis: The four T’s
  • 1. Transcription
    • In the nucleus: copying the plans
    • DNAmRNA
  • 2. Transport
    • Between the nucleus and the ribosome
    • mRNA in transit
  • 3. Translation
    • At the Ribosome: The plans are decoded
    • mRNA  tRNA
  • 4. Transfer and Protein Synthesis
    • tRNA + Amino Acid  builds protein chain.
transcription
Transcription
  • DNA can also copy short pieces of its code onto RNA molecules.
  • These RNA copies are called messenger RNA (mRNA for short)
steps of protein synthesis
Steps of Protein Synthesis

1. Transcription

  • DNAmRNA (or tRNA or rRNA)

2. Transport: Movement of RNA

  • mRNAribosomes

3. Transfer of amino acids at the ribosome

  • tRNA molecules bring amino acids to the ribosome

4. Translation of mRNA into a polypeptide chain

  • The tRNA molecules line up according to the mRNA template, positioning the amino acids to be joined together
transcription dna transcribed to mrna
TranscriptionDNA transcribed to mRNA

Transcription happens in the nucleus

transcription dna anticodons to mrna codons
Transcription: DNA anticodons to mRNA codons

The sequence of DNA anticodons is transcribed as codons in mRNA

A  U

C  G

G  C

T  A

2 transport messenger rna moves from the nucleus to ribosomes
2. Transport: Messenger RNA moves from the Nucleus to Ribosomes
  • The mRNA moves through the ER (endoplasmic reticulum) and the cytoplasm to find a ribosome.
  • The Ribosome is where protein synthesis occurs.
3 transfer at the ribosome
3. Transfer:(at the ribosome)
  • Transfer RNA (tRNA) bring amino acids to the ribosome to make the protein (AKA polypeptide chain).
  • Each tRNA has a specific, 3 nucleotide anticodon sequence exposed.
translation the trnas line up in sequence
Translation: the tRNAs line up in sequence
  • Proteins are synthesized based on the sequence of bases in the mRNA
  • The anticodons on the tRNA must line up with the codons on the mRNA
the genetic code
The Genetic Code
  • The information in the DNA is stored in a special code
  • The five symbols that make up the alphabet of the genetic code are A.U.C.G. and sometimes T. (corresponding to adenine, uracil, cytosine, guanine and sometimes Thymine)
  • Each “word” or “codon” consists of three of these symbols. This is why it is sometimes called the “triplet code”
uuu cuu aac ggg aag
UUU CUU AAC GGG AAG

Phenylalanine

Leucine

Lysine

Glycine

Lysine

  • A “codon” of the genetic code represents one specific amino acid
  • An “anticodon” is a codon with the opposite nucleotide bases compared to original codon
      • AT (DNA) or AU (RNA), CG (Both)
  • A “gene” is enough codons to specify all the amino acids in a particular protein.
the amino acids
The Amino Acids:
  • Amino Acids are the building blocks of proteins.
  • There are only 20 different amino acids used to build all the proteins in a human.
  • Each codon represents a different amino acid.
  • There are 64 possible codons, so several of them are used for other purposes (start, stop, duplicates).
  • Proteins start out as polypeptide chains so the term polypeptide is sometimes used as a synonym for protein.
the 64 codons and their amino acids
The 64 Codons and their Amino Acids

This table is also in your textbook

(page 194)

Page 194!

dna codons and anticodons
DNA Codons and Anticodons
  • The Codons are usually listed as they occur on mRNA, but DNA and tRNA have codons too, but they are the opposite codons (or anticodons) of the mRNA ones.
example done together

Page 194!

Example: (done together)
  • A DNA molecule has the following anticodons on part of one chain: TACAGCTTTTCAGATACCCATACT What amino acids do they code for?
  • Step 1: find the correct codons.
    • AUG UCG AAA AGU CUA UGG GUA UGA
  • Step 2: find the Amino Acids (short)
    • Start Ser- Lys- Ser- Leu- Try- Val- Stop
  • Answer: the protein would contain:
    • Serine, lysine, serine, leucine, tryptophan, and valine (in that order!)
example now you try it
Example: Now you try it
  • A DNA molecule has the following anticodons on part of one chain: TACAGCTTTACGGGGACCACT What amino acids do they code for?
  • Step 1: find the correct codons.
    • AUG-UCG-AAA-UGC-CCC-UGG-UGA
  • Step 2: find the Amino Acids (short)
    • Start-Ser-Lys-Cys-Pro-Try-Stop
  • Answer: the protein would contain:
    • serine, lysine, cysteine, proline, and tryptophan (in that order!)
dna and protein synthesis videos
DNA and Protein Synthesis Videos
  • Protein Synthesis (computer animation)
  • Protein Synthesis (hand made stop motion)
  • Translation (virtual cell)
protein synthesis
Protein Synthesis
  • Lab report (DNA extraction) due ASAP
  • Reading and assignments
    • Read pages 185 to 196
    • Create a representation of the process of protein synthesis in a way that you can remember (group of diagrams, written description, mind-map, list of main ideas)
    • Answer questions 1-20 on p198