phylogeny n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Phylogeny PowerPoint Presentation
Download Presentation
Phylogeny

Loading in 2 Seconds...

play fullscreen
1 / 44

Phylogeny - PowerPoint PPT Presentation


  • 90 Views
  • Uploaded on

Phylogeny. Vocabulary of Phylogenetic Trees. Graph of edges and nodes that illustrates the evolutionary relationships among “Operational Taxonomic Units or OTUs” Topology refers to the branching pattern. http://www.ncbi.nlm.nih.gov/About/primer/phylo.html.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Phylogeny' - afric


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
vocabulary of phylogenetic trees
Vocabulary of Phylogenetic Trees
  • Graph of edges and nodes that illustrates the evolutionary relationships among “Operational Taxonomic Units or OTUs”
  • Topology refers to the branching pattern

http://www.ncbi.nlm.nih.gov/About/primer/phylo.html

rooting and scaling same tree different look
Rooting and Scaling – Same tree, different look?

http://www.ncbi.nlm.nih.gov/About/primer/phylo.html

three different rooted trees consistent with a four taxon unrooted tree
Three different rooted trees consistent with a four taxon unrooted tree

What is the total number of possible rooted trees consistent with this unrooted tree?

http://www.ncbi.nlm.nih.gov/About/primer/phylo.html

how many possible trees for n taxa
How many possible trees for n taxa?

Number of Rooted Trees = (2n -3)!

(2 n -2) (n -2)!

Number of Unrooted Trees = (2n -5)!

(2 n -3) (n -3)!

phylogeny and genomics
Phylogeny and Genomics
  • A species tree provides a framework for analyzing presence and absence of genes in genomes (or traits in organisms)
    • The species tree may be unknown
  • A genome is a (comprehensive) source of DNA and (predicted) protein sequences to use for phylogenetic reconstruction
    • Different regions of the genome may support different trees
  • Trees are useful for examining evolutionary history of gene families
    • Knowledge of the species tree affects interpretation of gene family trees.
knowing the relationship between strains and species provides a framework for interpretation
Knowing the relationship between strains and species provides a framework for interpretation

Pantoea stewartii

Erwinia carotovora

Salmonella enterica

Yersinia pestis

a reasonable guess based on the character host type
A reasonable guess based on the character “host type”

But is this a good choice if the goal is to reconstruct the “species tree”?

Why might you choose to build your tree based on a molecular sequence data rather than phenotype even if what you are really interested in is the evolution of host range?

Pantoea stewartii

Erwinia carotovora

Salmonella enterica

Yersinia pestis

best tree from molecular phylogenetic analysis using multiple core metabolism proteins
Best tree from molecular phylogenetic analysis using multiple core metabolism proteins

Pantoea stewartii

Why choose to use multiple genes or proteins instead of one?

Why choose core metabolism proteins?

Why might it be a bad idea?

Salmonella enterica

Erwinia carotovora

Yersinia pestis

“True” species tree?

mapping the trait of interest phenotypes presence absence of genes onto the species tree
Mapping the trait of interest (phenotypes, presence/absence of genes) onto the species tree

Signaling system

+

Pantoea stewartii

-

Salmonella enterica

+

Erwinia carotovora

-

Yersinia pestis

“True” species tree

Trait/Gene of Interest

from multiple alignment to phylogeny
From Multiple Alignment to Phylogeny

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Organism A

Organism B

Organism C

Organism D

Organism E

four approaches to tree reconstruction
Four Approaches to Tree Reconstruction
  • Distance Methods (MEGA, PAUP, Phylip)
    • Estimate a distance matrix
    • Infer topology and branch lengths
  • Maximum Parsimony (PAUP)
    • Sift through all possible trees to find “the one” that requires the smallest number of evolutionary events
  • Maximum Likelihood (PAUP)
    • Find the tree most likely to have generated the sequence data
  • Bayesian (MrBayes)
    • Produce a probability distribution for all (or a well sampled subset) possible trees using MCMC to explore tree space
distance matrices and data types
Distance matrices and data types
  • DNA sequence
  • Protein sequence
  • Shared gene content
  • Similarity of gene expression profile
  • Anything you can represent as a pair-wise distance between OTUs
dna or protein
DNA or Protein?

DNA

Protein

Evolutionary models are available (empirical)

Conserved enough to use for distantly related OTUs

Can only be used for proteins

20 characters

  • Well developed evolutionary models
  • Vary among closely related OTUs
  • Can be used for regions other than protein coding genes
  • Can be partitioned into synoymous/nonsynonymous
  • “Saturate” faster than proteins because there are only 4 characters (GATC)
distance in its simplest form is a count of the differences between two sequences
Distance – in its simplest form is a count of the differences between two sequences

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.........a.......a.....................................g.... Organism D

.......a.a.............................................g.... Organism E

A B C D E

Organism A - 0 4 3 3

Organism B - 4 3 3

Organism C - 4 4

Organism D - 2

Organism E -

USE AN EVOLUTIONARY MODEL TO CORRECT THE DISTANCE MATRIX FOR UNOBSERVED CHANGES.

five models for nucleotide substitution there are others
Five Models for Nucleotide Substitution(There are others)

Jukes and Cantor, 1969

All substitutions are equally likely

Kimura, 1980

Transitions are more likely than transversions

Tamura

Transitions are more likely that transversions and

GC content does not equal AT content.

Tamura and Nei

Transitions are more likely than transversions AND

GC-content doesn’t equal the AT-content AND

there is a rate difference between G-A and T-C transitions

Unrestricted

There is no discernable relationship between rates

models of nucleotide substitution
Models of Nucleotide Substitution

An element of eij of the matrix stands for the substitution rate from the nucleotide in the ith row to the nucleotide in the jth column

A T C G

A - a a a

T a - a a

C a a - a

G a a a -

A T C G

A - b b a

T b - a b

C b a - a

G a b b -

Jukes-Cantor

Kimura

rate heterogeneity
Rate Heterogeneity
  • Instead of assuming a uniform distribution across the alignment allow rate to vary according to the gamma family of distributions

Alpha < 1 there is strong among-site variation

Higher alpha, lower heterogeneity

Can be estimated for individual data sets

infer topology and branch lengths from the matrix using an algorithm like upgma
Infer topology and branch lengths from the matrix using an algorithm like UPGMA

UPGMA (Unweighted Pair Group Method with Arithmetic mean) is a simple method that is also used for microarray clustering.

Assumes constant rates of evolution among different lineages -> linear relationship between distance and time

A B C D E

Organism A - 0.00 0.04 0.03 0.03

Organism B - 0.04 0.03 0.03

Organism C - 0.04 0.04

Organism D - 0.02

Organism E -

slide20

UPGMA Step 1-

Cluster the Operational Taxonomic UnitsOTUs with the smallest distance with branch length = d/2

A B C D E

Organism A - 0.00 0.04 0.03 0.03

Organism B - 0.04 0.03 0.03

Organism C - 0.04 0.04

Organism D - 0.02

Organism E -

Organism A

Organism B

time

slide21

UPGMA Step 2-

Collapse the distance matrix to reflect distance from the AB group by taking the average of the distance from A-all others and B-all others

A B C D E

Organism A - 0.00 0.04 0.03 0.03

Organism B - 0.04 0.03 0.03

Organism C - 0.04 0.04

Organism D - 0.02

Organism E -

AB C D E

Group AB - 0.04 0.03 0.03

Organism C - 0.04 0.04

Organism D - 0.02

Organism E -

slide22

UPGMA Step 3-

  • Repeat Step 1 with the collapsed distance matrix
      • Step 1- Cluster OTUs with the smallest distance with branch length = d/2

AB C D E

Group AB - 0.04 0.03 0.03

Organism C - 0.04 0.04

Organism D - 0.02

Organism E -

Organism A

Organism B

0.01

Organism D

Organism E

0.01

time

slide23

UPGMA Step 4- n

Continue to collapse and join until all taxa are added

AB C DE

Group AB - 0.04 0.03

Organism C - 0.04

Group DE -

ABDE C

Group ABDE - 0.04

Organism C -

0.015

Organism A

Organism B

0.005

0.01

Organism D

Organism E

0.005

0.01

0.02

Organism C

time

alternative to upgma that does not assume a constant evolutionary rate
Alternative to UPGMA that does not assume a constant evolutionary rate

Neighbor-joining takes a step-wise approach similar to UPGMA, but chooses branch lengths that minimize the total branch length (minimum evolution) at every step.

Not guaranteed to get the overall optimal (minimal branch length) tree because it is a greedy algorithm.

Distance methods are fast and scale well for large number of taxa.

slide25

Maximum Parsimony - Sift through all possible trees to find “the one” that requires the smallest number of evolutionary events

With so many trees, it is often necessary to use a heuristic approach that looks at a subset of all possible trees (TBR, Branch and Bound)

(2n-5)!

2n-3(n-3)!

(2n-3)!

2n-2(n-2)!

rooted

unrooted

Organism A

Organism B

Organism D

Organism E

Organism C

time

maximum parsimony
Maximum Parsimony

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

g -> a

Organism A a

Organism B a

1 event

g

g

Organism D g

Organism E g

g

Organism C g

time

slide27

Maximum Parsimony

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Organism A a

Organism E g

3 events

a

a -> g

Organism D g

Organism B a

a -> g

a

Organism C g

a -> g

time

slide28

Maximum Parsimony

1 event

Right tree?

3 events

Wrong tree?

g -> a

Organism A

Organism B

Organism A a

Organism E g

g

a

a -> g

g

Organism D

Organism E

Organism D g

Organism B a

a -> g

g

a

Organism C

Organism C g

a -> g

time

time

slide29

Maximum Parsimony

1 event

Right tree?

3 events

Wrong tree?

g -> a

Organism A

Organism B

Organism A a

Organism E g

g

a

a -> g

g

Organism D

Organism E

Organism D g

Organism B a

a -> g

g

a

Organism C

Organism C g

a -> g

time

time

maximum likelihood methods
Maximum Likelihood Methods
  • Given an evolutionary model, evaluate all possible tree topologies and calculate the probability of generating the observed data.
  • Choose the tree with the highest probability (generally expressed as the log likelihood)
  • Computationally intensive and sensitive to model selection
slide31

Bootstrapping

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

A method of testing the reliability of the tree

100%

Organism A

Organism B

Organism C

Organism D

Organism E

50%

100%

slide32

Bootstrap to Assess Confidence in Branches

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Resample with replacement to produce

1000 alignments of the same size

c

.

.

.

.

slide33

Bootstrap to Assess Confidence in Branches

ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Resample with replacement to produce

1000 alignments of the same size

c c

. .

. .

. .

. .

slide34

Bootstrap to Assess Confidence in Branches

ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Resample with replacement to produce

1000 alignments of the same size

c c a

. . .

. . g

. . .

. . .

slide35

Bootstrap to Assess Confidence in Branches

ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Resample with replacement to produce

1000 alignments of the same size

c c a t g g a

. . . . . . .

. . g . . . g

. . . . . a .

. . . . . . .

slide36

Many different Alignments

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

slide37

Many different Alignments

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

What percentage of the datasets support each branch?

100%

Organism A

Organism B

Organism C

Organism D

Organism E

50%

100%

bootstrapping and what it really tells us
Bootstrapping and what it really tells us.

The underlying rational behind bootstrapping is to predict what would happen if more data were collected or small perturbations were made to the existing data. Bootstrapping does not indicate the chance that the branch topology is in the correct location. (Holder, M., Lewis, P. 2003)

More simulated data

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

Ggaccttcgggcctcacgccatcggatgaacccagatgggattagctagtaggtgaggta Organism A

............................................................ Organism B

............................tg.................g.......g.... Organism C

.................a.....................................g.... Organism D

.......a...............................................g.... Organism E

genome scale phylogeny
Genome-scale phylogeny
  • Total Evidence approach - generate one tree from all available data
  • Consensus approach – generate a tree for each gene and generate an average tree
  • Network approach – show different relationships for different genes rather than a single bifurcating tree
slide40

Total Evidence – concated 976 protein multiple alignments

Majority Rule Consensus -976 separate Bayesian phylogenies

Network representation of all topologies

Ma et al. unpublished analysis of 976 sets of orthologs from 8 enterobacteria and an outgroup.

an example of incongruence between different genes in lactobacillus genomes
An example of incongruence between different genes in Lactobacillus genomes

Nicolas et al. BMC Evolutionary Biology 2007; 7:141

Analyzed 480 proteins

3:2 ratio of genes supporting Ta vs. Tb, but Tc is almost never seen.