1 / 7

Baseline: Are we at the same stage? Cygwin installed Blast installed Data files:

Baseline: Are we at the same stage? Cygwin installed Blast installed Data files: TA496Seq1.txt, PhytophSeq1.txt, TomatoSequence.txt Were the files completely downloaded? In Cygwin Try: grep –c “>” PhytophSeq1.txt 3,921 Try: grep –c “>” TA496Seq1.txt 116,711. Format the database:

aderes
Download Presentation

Baseline: Are we at the same stage? Cygwin installed Blast installed Data files:

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Baseline: Are we at the same stage? Cygwin installed Blast installed Data files: TA496Seq1.txt, PhytophSeq1.txt, TomatoSequence.txt Were the files completely downloaded? In Cygwin Try: grep –c “>” PhytophSeq1.txt 3,921 Try: grep –c “>” TA496Seq1.txt 116,711

  2. Format the database: /cygdrive/c/Blast/bin/formatdb -i ./TA496Seq1.txt –p F Run nucleotide BLAST (blastn) /cygdrive/c/Blast/bin/blastall -p blastn -d ./TA496Seq1.txt -i ./TomatoSequence.seq –o TomatoSeqOut.txt /cygdrive/c/Blast/bin/blastall -p blastn -d ./TA496Seq1.txt -i ./PhtophSeq1.txt –o PhytOut.txt NOTE: this blast which compares 3,921 sequences to a database of 116,711 sequences will take some time (15 minutes on my laptop).

  3. OUTPUT of BLAST of TA496Seq1.txt with TomatoSequence.txt Score E Sequences producing significant alignments: (bits) Value gi|9292199|gb|BE354223.1|BE354223 EST355566 tomato flower buds, ... 1237 0.0 gi|16248018|gb|BI933546.1|BI933546 EST553435 tomato flower, anth... 1017 0.0 gi|4384985|gb|AI489614.1|AI489614 EST247953 tomato ovary, TAMU S... 908 0.0 gi|7410529|gb|AW649291.1|AW649291 EST327745 tomato germinating s... 40 0.12 gi|8105118|gb|AW929717.1|AW929717 EST353987 tomato flower buds 8... 40 0.12 . . . gi|16248689|gb|BI934217.1|BI934217 EST554106 tomato flower, anth... 34 7.2 gi|16248853|gb|BI934381.1|BI934381 EST554270 tomato flower, anth... 34 7.2

  4. OUTPUT of BLAST of TA496Seq1.txt with TomatoSequence.txt >gi|9292199|gb|BE354223.1|BE354223 EST355566 tomato flower buds, anthesis, Cornell University Solanum lycopersicum cDNA clone cTOD9L3, mRNA sequence Length = 632 Score = 1237 bits (624), Expect = 0.0 Identities = 630/632 (99%) Strand = Plus / Plus Query: 1504 gactggctagaatggctgcaatcatggcatctacttacaaggcttatcttggcgtcggac 1563 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 gactggctagaatggctgcaatcatggcatctacttacaaggcttatcttggcgtcggac 60 Query: 1564 ttggtccactatcatttttgacgcagtatagaataccacatcctggaagagttggtggaa 1623 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 ttggtccactatcatttttgacgcagtatagaataccacatcctggaagagttggtggaa 120

  5. OUTPUT of BLAST of TA496Seq1.txt with TomatoSequence.txt >gi|9292199|gb|BE354223.1|BE354223 EST355566 tomato flower buds, anthesis, Cornell University Solanum lycopersicum cDNA clone cTOD9L3, mRNA sequence Length = 632 Score = 1237 bits (624), Expect = 0.0 Identities = 630/632 (99%) Strand = Plus / Plus Query: 1504 gactggctagaatggctgcaatcatggcatctacttacaaggcttatcttggcgtcggac 1563 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 gactggctagaatggctgcaatcatggcatctacttacaaggcttatcttggcgtcggac 60 Query: 1564 ttggtccactatcatttttgacgcagtatagaataccacatcctggaagagttggtggaa 1623 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 ttggtccactatcatttttgacgcagtatagaataccacatcctggaagagttggtggaa 120

  6. In Cygwin Try: grep –c “Strand =“ ./TomatoSeqOut.txt 82 Try: grep –c “Stand =“ ./PhytOut.txt 292,568 Try: grep –c “Expect = 0.0” ./TomatoSeqOut.txt 3 Try: grep –c “Expect = 0.0” ./PhytOut.txt 54,643

  7. When we have a large output file from BLAST, how can we find out what is inside? How can we organize and interpret this output when the file is too large to open in a text editor?

More Related