slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Tema 5. Replicación PowerPoint Presentation
Download Presentation
Tema 5. Replicación

Loading in 2 Seconds...

play fullscreen
1 / 74

Tema 5. Replicación - PowerPoint PPT Presentation


  • 173 Views
  • Uploaded on

Tema 5. Replicación. contenido. • La replicaci ón: semiconservativa y bidireccional • Mecanismo y enzimología de la replicación • La iniciaci ón y la horquilla de replicación • Análisis de la frecuencia del vecino más próximo • Replicaci ón del cromosoma de E. coli

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Tema 5. Replicación' - ace


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
contenido
contenido

• La replicación: semiconservativa y bidireccional

• Mecanismo y enzimología de la replicación

• La iniciación y la horquilla de replicación

• Análisis de la frecuencia del vecino más próximo

• Replicación del cromosoma de E. coli

• Replicación de otros genomas circulares

• Replicación eucariótica: orígenes y telómeros

slide9

generaciones

0

1

1,9

3

P H L

P H L

Meselson y Stahl, 1958

0

1

2

3

slide10

Taylor,

Woods y

Hughes,

1957

slide14

el genoma bacteriano es un DNA circular

la replicación mantiene la integridad del círculo

slide20

complementariedad

y

antiparalelismo

slide23

actividad

correctora de pruebas

de la DNA polimerasa III

slide25

cadenas

continua

y discontinua

leading: continua

lagging: discontinua

slide26

PolIII

PolI

fragmentos de Okazaki

primasa

ligasa

slide27

horquilla

de replicación

slide32

Análisis de la frecuencia del vecino más próximo

(Kornberg, 1957)

fidelidad de la replicación

slide37

Bidirectional replication

of the E. coli chromosome

El cromosoma de E. coli es

un único replicón

(unidad de replicación)

secuencia de oric
secuencia de oriC

1

50

100

GGATCCTGGGTATTAAAAAGAAGATCTATTTATTTAGAGATCTGTTCTATTGTGATCTCTTATTAGGATCGCACTGCCCTGTGGATAACAAGGATCCGGC

R1

AT L

M

R

13mero

13mero

13mero

101

150

200

TTTTAAGATCAACAACCTGGAAAGGATCATTAACTGTGAATGATCGGTGATCCTGGACCGTATAAGCTGGGATCAGAATGAGGGGTTATACACAACTCAA

IHF

R2

M

201

250

300

AAACTGAACAACAGTTGTTCTTTGGATAACTACCGGTTGATCCAAGCTTCCTGACAGAGTTATCCACAGTAGATCGCACGATCTGTATACTTATTTGAGT

R4

FIS

R3

slide40

iniciación de la replicación en E. coli

DnaA reconoce oriC abre los 13meros entra helicasa DnaB

slide53

círculo rodante

plásmidos (F)

y fagos

slide57

lazo D

mitocondria y

cloroplasto

slide64

eukaryotic-replicating fork

presence of histone protein-containing nucleosomes

on both branches

slide66

telómeros:

replicación de los extremos

de cromosomas lineales

(cromosomas eucarióticos)

slide70

los telómeros se pierden

con el aumento de las duplicaciones celulares

16 divisiones

61 divisiones

problemas
problemas

capítulo 2

2ª ed.: 2.1-2.5, 2.26 y el 1.23 (+2.7-3ª ed)

3ª ed.: 2.1-2.8

1 h de clase: 6-noviembre-2009

slide74

2.7-3ª ed

En un laboratorio se sintetizan dos tipos de antibióticos contra las infecciones víricas, A y B, siendo muy similares a los nucleótidos utilizados normalmente por lo que pueden ser incorporados al DNA durante la replicación, pero A es incapaz de unirse por su extremo 3’ a otros nucleótidos y B es incapaz de hacerlo por su extremo 5’.

Si incorporamos A o B a un virus en replicación, ¿cúal de ellos será más eficaz para impedir que continúe la síntesis de DNA y, por tanto, la infección vírica?