acacia
Uploaded by
21 SLIDES
525 VIEWS
210LIKES

Virus structure, classification and replication

DESCRIPTION

Virus structure, classification and replication. Under attack!.

1 / 21

Download Presentation

Virus structure, classification and replication

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Virus structure, classification and replication

  2. Under attack! Major target tissues of viral disease. (*) indicates progressive multifocal leukoencephalopathy. Infection by viruses indicated by (**) results in an immune-mediated rash. (From Medical Microbiology, 5th ed., Murray, Rosenthal & Pfaller, Mosby Inc., 2005, Fig. 68-1.)

  3. Structures compared Components of the basic virion (From Medical Microbiology, 5th ed., Murray, Rosenthal & Pfaller, Mosby Inc., 2005, Fig. 6-4.)

  4. DNA or RNA Basic virus structure Capsid protein Naked capsid virus Nucleocapsid + = Lipid membrane, glycoproteins Nucleocapsid Enveloped virus +

  5. Matrix Lipid Glycoprotein Capsid symmetry Icosahedral Helical Naked capsid Enveloped

  6. Adenovirus Electron micrograph Foot and mouth disease virus Crystallographic model Icosahedral naked capsid viruses http://virology.wisc.edu/virusworld/ICTV8/fmd-foot-and-mouth-ictv8.jpg http://www.ncbi.nlm.nih.gov/ICTVdb/Images/Ackerman/Animalvi/Adenovir/799-16.htm

  7. Helical naked capsid viruses RNA Protein http://www.ncbi.nlm.nih.gov/ICTVdb/ICTVdB/em_tmv.gif Caspar and Klug, Adv Virus Res. 1960;7:225-325 Tobacco mosaic virus Electron micrograph Tobacco mosaic virus Model

  8. Icosahedral enveloped viruses http://web.uct.ac.za/depts/mmi/stannard/emimages.html http://virology.wisc.edu/virusworld/images/herpescapsid.GIF Herpes simplex virus Electron micrograph Herpes simplex virus Nucleocapsid cryoEM model

  9. Helical enveloped viruses http://web.uct.ac.za/depts/mmi/stannard/fluvirus.html http://web.uct.ac.za/depts/mmi/stannard/paramyx.html Influneza A virus Electron micrograph Paramyxovirus Electron micrograph

  10. Properties of enveloped viruses • Envelope is sensitive to • Drying • Heat • Detergents • Acid • Consequences • Must stay wet during transmission • Transmission in large droplets and secretions • Cannot survive in the gastrointestinal tract • Do not need to kill cells in order to spread • May require both a humoral and a cellular immune response Adapted from Murray, P.R. Rosenthal K.S., Pfaller, M.A. (2005) Medical Microbiology, 5th edition, Elsevier Mosby, Philadelphia, PA Box 6-5

  11. Properties of naked capsid viruses • Capsid is resistant to • Drying • Heat • Detergents • Acids • Proteases • Consequences • Can survive in the gastrointestinal tract • Retain infectivity on drying • Survive well on environmental surfaces • Spread easily via fomites • Must kill host cells for release of mature virus particles • Humoral antibody response may be sufficient to neutralize infection Adapted from Murray, P.R. Rosenthal K.S., Pfaller, M.A. (2005) Medical Microbiology, 5th edition, Elsevier Mosby, Philadelphia, PA , Box 6-4

  12. Taxonomy of the Order Mononegavirales a V, vertebrate; I, insect; P, plant. Fields Vriology (2007) 5th edition, Knipe, DM & Howley, PM, eds, Wolters Kluwer/Lippincott Williams & Wilkins, Philadelphia Table 2.2

  13. Classification of Human Viruses Fields Vriology (2007) 5th edition, Knipe, DM & Howley, PM, eds, Wolters Kluwer/Lippincott Williams & Wilkins, Philadelphia Table 2.1

  14. Diagrams of the vertebrate viruses. Diagrams are drawn to relative scale and grouped by genome type or replication strategy (reverse transcription). (From Fauquet, CM, Mayo MA, Maniloff J et al. Virus Taxonomy: Eighth report of the International Committee on Taxonomy of Viruses. London: Elsevier Inc., 2005.)

  15. Major diseases caused by human viruses

  16. Virus replication: general

  17. Variations on the replication theme From Schaechter’s Mechanisms of Microbial Disease; 4th ed.; Engleberg, DiRita & Dermody; Lippincott, Williams & Wilkins; 2007; Fig. 31-7

  18. + - + and - RNA M K A K L L V L L C A L A A T D A D T I F1 * R Q N Y W S C Y V H L Q L Q M Q T Q Y F2 E G K T T G P V M C T C S Y R C R H N M F3 5’ atgaaggcaaaactactggtcctgttatgtgcacttgcagctacagatgcagacacaata 3’ ----:----|----:----|----:----|----:----|----:----|----:----| 3’ tacttccgttttgatgaccaggacaatacacgtgaacgtcgatgtctacgtctgtgttat 5’ X F A F S S T R N H A S A A V S A S V I F6 X S P L V V P G T I H V Q L * L H L C L F5 H L C F * Q D Q * T C K C S C I C V C Y F4 • + sense RNA viruses package + polarity RNA in virions as genome. • This + sense RNA can be translated directly into protein upon uncoating of the virion in the cell • - sense RNA viruses package - polarity RNA in virions as genome. • This - sense RNA must be transcribed by a virus coded, virion packaged RNA dependent RNA polymerase immediately following uncoating.

  19. + and - RNA M K A K L L V L L C A L A A T D A D T I F1 * R Q N Y W S C Y V H L Q L Q M Q T Q Y F2 E G K T T G P V M C T C S Y R C R H N M F3 5’ atgaaggcaaaactactggtcctgttatgtgcacttgcagctacagatgcagacacaata 60 ----:----|----:----|----:----|----:----|----:----|----:----| 3’ tacttccgttttgatgaccaggacaatacacgtgaacgtcgatgtctacgtctgtgttat 60 X F A F S S T R N H A S A A V S A S V I F6 X S P L V V P G T I H V Q L * L H L C L F5 H L C F * Q D Q * T C K C S C I C V C Y F4 C I G Y H A N N S T D T V D T L L E K N F1 V * A T M R T T Q P T L L T H Y S R R M F2 Y R L P C E Q L N R H C * H T T R E E C F3 61 tgtataggctaccatgcgaacaactcaaccgacactgttgacacactactcgagaagaat 3’ ----:----|----:----|----:----|----:----|----:----|----:----| 61 acatatccgatggtacgcttgttgagttggctgtgacaactgtgtgatgagctcttctta 5’ H I P * W A F L E V S V T S V S S S F F F6 I Y L S G H S C S L R C Q Q C V V R S S F5 T Y A V M R V V * G V S N V C * E L L I F4

  20. Virus growth 1,000 – 100,000 viruses/cell, 5 – 24 hours From Schaechter’s Mechanisms of Microbial Disease; 4th ed.; Engleberg, DiRita & Dermody; Lippincott, Williams & Wilkins; 2007; Fig. 31-8

  21. Summary: structure,classification & replication • Structure • Nucleic acid in a protein shell, +/- lipid envelope • Structure impacts on biological properties • Classification • Many virus families, organized by structure and biology • Replication • Generic scheme • Varying strategies depending on nucleic acid

More Related