1 / 70

What do genes look like?

What do genes look like?. I. Genes – segments of DNA that carry hereditary instructions and are passed from parent to offspring; genes are located on chromosomes. Chromosome Structure of Eukaryotes. Section 12-2. Nucleosome. Chromosome. DNA double helix. Coils. Supercoils. Histones.

abbottj
Download Presentation

What do genes look like?

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. What do genes look like?

  2. I. Genes – segments of DNA that carry hereditary instructions and are passed from parent to offspring; genes are located on chromosomes

  3. Chromosome Structure of Eukaryotes Section 12-2 Nucleosome Chromosome DNA double helix Coils Supercoils Histones Go to Section:

  4. DNA – Hereditary material that controls all the activities of a cell and provides the instructions for making proteins • DNA is made of nucleotides • Nucleotides have three parts; 5-carbon sugar, phosphate group and a nitrogen base

  5. Nucleotides are identical except for the nitrogen base • A nucleotide can contain 1 of 4 Nitrogen Bases – • Adenine • Guanine • Cytosine • Thymine

  6. Nucleotide Phosphate Group Nitrogen Base Can Be: Adenine Guanine Cytosine Thymine Sugar

  7. 3. The amount of Adenine = Thymine, Cytosine = Guanine (Chargaff’s Rule)

  8. III. The Double Helix- 1953, 2 American scientists, Watson and Crick, discovered the structure of DNA using the X-rays made by Rosalind Franklin

  9. 2 strands wound around each other like a twisted ladder • Strands are held together by hydrogen bonds between the nitrogen bases • Adenine bonds to Thymine and Cytosine bonds to Guanine

  10.  Structure of DNA Section 12-1 Nucleotide Hydrogen bonds Sugar-phosphate backbone Key Adenine (A) Thymine (T) Cytosine (C) Guanine (G) Go to Section:

  11. Cocke’s First Love

  12. IV. Replication: Before a cell divides, DNA on every chromosome is copied so that each new cell has an identical set of chromosomes

  13. AGTCCGATCGTAACTGGGTCACATCGTAAGTGTACACGTA |||||||||||||||||||||||||||||||||||||||| TCAGGCTAGCATTGACCCAGTGTAGCATTCACATGTGCAT DNA Replication IV. Replication: Before a cell divides, DNA on every chromosome is copied so that each new cell has an identical set of chromosomes TAAGTGTACACGTA ATTCACATGTGCAT TAAGTGTACACGTA TCACATCG TAAGTGTACACGTA TCACATCG TCACATCG TCACATCG TAAGTGTACACGTA AGTCCGATCGTAACTGGG |||||||||||||||||||||| |||||||||||||||||| AGTGTAGC ATTCACATGTGCAT TCAGGCTAGCATTGACCC AGTGTAGC AGTGTAGC ATTCACATGTGCAT TAAGTGTACACGTA ATTCACATGTGCAT

  14. Make a complimentary strand ATT CGT ACG TTT ACT

  15. Make a complimentary strand ATT CGT ACG TTT ACT

  16. Make a complimentary strand ATT CGT ACG TTT ACT TAA

  17. Make a complimentary strand ATT CGT ACG TTT ACT TAA GCA

  18. Make a complimentary strand ATT CGT ACG TTT ACT TAA GCA TGC

  19. Make a complimentary strand ATT CGT ACG TTT ACT TAA GCA TGC AAA

  20. Make a complimentary strand ATT CGT ACG TTT ACT TAA GCA TGC AAA TGA

  21. Making the Traits! I. How DNA works to create our traits – DNA cannot leave the nucleus. A copy of the DNA code is made in the nucleus into RNA. RNA travels to the ribosome where the code is read and the protein is assembled

  22. The nitrogen bases in every gene make a code • Every three bases makes one codon • One codon is the code for one amino acid • Long chains of amino acids make proteins • ****Proteins determine an organisms traits and characteristics

  23. Making a Protein – Translation Section 12-3 Nucleus Messenger RNA Messenger RNA is transcribed in the nucleus. mRNA Lysine Phenylalanine tRNA Transfer RNA The mRNA then enters the cytoplasm and attaches to a ribosome. Translation begins at AUG, the start codon. Each transfer RNA has an anticodon whose bases are complementary to a codon on the mRNA strand. The ribosome positions the start codon to attract its anticodon, which is part of the tRNA that binds methionine. The ribosome also binds the next codon and its anticodon. Methionine Ribosome Start codon mRNA Go to Section:

  24. Making a Protein Section 12-3 The Polypeptide “Assembly Line” The ribosome joins the two amino acids—methionine and phenylalanine—and breaks the bond between methionine and its tRNA. The tRNA floats away, allowing the ribosome to bind to another tRNA. The ribosome moves along the mRNA, binding new tRNA molecules and amino acids. Growing polypeptide chain Ribosome tRNA Lysine tRNA mRNA Completing the Polypeptide The process continues until the ribosome reaches one of the three stop codons. The result is a growing polypeptide chain. mRNA Translation direction Ribosome Go to Section:

  25.  The Genetic Code Making a Protein: Translation DNA in the Nucleus: ATA GCT CCG TTA Code is made into RNA: UAU CGA GGC AAU ***In RNA Thymine is replaced by Uracil Amino Acid Chain is made at the ribosome: Tyrosine: Arginine: Glycine: ___________ Go to Section:

  26.  The Genetic Code Making a Protein: DNA in the Nucleus: ATA GCT CCG TTA Code is made into RNA: UAU CGA GGC AAU ***In RNA Thymine is replaced by Uracil Amino Acid Chain is made at the ribosome: Tyrosine: Arginine: Glycine: Asparagine http://www.learnerstv.com/animation/biology/Proteinsynthesis.swf Go to Section:

  27.  The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: Go to Section:

  28.  The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: AAU Go to Section:

  29.  The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: AAU AAA Go to Section:

  30.  The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: AAU AAA GGG Go to Section:

  31.  The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: AAU AAA GGG UUA Amino Acid Chain (Protein): Go to Section:

  32.  The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: AAU AAA GGG UUA Amino Acid Chain (Protein): Asparagine: Go to Section:

  33.  The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: AAU AAA GGG UUA Amino Acid Chain (Protein): Asparagine: Lysine Go to Section:

  34.  The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: AAU CGC GGG UUA Amino Acid Chain (Protein): Asparagine: Lysine: Glycine: Go to Section:

  35.  The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: AAU AAA GGG UUA Amino Acid Chain (Protein): Asparagine: Lysine: Glycine: Leucine This protein will determine a characteristic or trait Go to Section:

  36.  The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: Go to Section:

  37.  The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: UUU Go to Section:

  38.  The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: UUU AGA Go to Section:

  39.  The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: UUU AGA CUG Go to Section:

  40.  The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: UUU AGA CUG GUA Amino Acid Chain (Protein): Go to Section:

  41.  The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: UUU AGA CUG GUA Amino Acids Chain (Protein): Phenylalanine: Go to Section:

  42.  The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: UUU AGA CUG GUA Amino Acids Chain (Protein): Phenylalanine: Arginine: Go to Section:

  43.  The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: UUU AGA CUG GUA Amino Acids Chain (Protein): Phenylalanine: Arginine: Leucine: Go to Section:

  44.  The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: UUU AGA CUG GUA Amino Acids Chain (Protein): Phenylalanine: Arginine: Leucine: Valine This protein will now determine a trait or a characteristic Go to Section:

  45. Structure of DNA Section 12-1 Nucleotide Hydrogen bonds Sugar-phosphate backbone Key Adenine (A) Thymine (T) Cytosine (C) Guanine (G) Go to Section:

  46. III. Mutations- changes in the DNA sequence that affect genetic information (not all are harmful) Can affect all types of cells A. Germ Mutations- affect sex cells – inherited by offspring (ex- Down Syndrome) B. Somatic Mutations – affect other cells- not inherited (many cancers caused by somatic mutations)

More Related