evolutionary genomics of mycobacterial pathogens 2 on the origin of tuberculosis l.
Download
Skip this Video
Download Presentation
Evolutionary genomics of mycobacterial pathogens - 2 (On the origin of tuberculosis)

Loading in 2 Seconds...

play fullscreen
1 / 39

Evolutionary genomics of mycobacterial pathogens - 2 (On the origin of tuberculosis) - PowerPoint PPT Presentation


  • 257 Views
  • Uploaded on

Evolutionary genomics of mycobacterial pathogens - 2 (On the origin of tuberculosis). Stewart Cole. M. bovis. M. tuberculosis. Proposed origin. M. tuberculosis derived from M. bovis. Or was it?.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Evolutionary genomics of mycobacterial pathogens - 2 (On the origin of tuberculosis)' - Solomon


Download Now An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide2

M. bovis

M. tuberculosis

Proposed origin

M. tuberculosis derived from M. bovis

Or was it?

recent evolution of tb bacilli

Proc. Natl. Acad. Sci. USAVol. 94, pp. 9869-74, September 1997GeneticsRestricted structural gene polymorphism in the Mycobacterium tuberculosis complex indicates evolutionarily recent global disseminationS. Sreevatsan, X. Pan, K.E. Stockbauer, N.D. Connell, B.N. Kreiswirth, T.S. Whittam AND J.M. MusserSection of Molecular Pathobiology, Department of Pathology, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA.Communicated by B.R. Bloom, Albert Einstein College of Medicine, Bronx, NY, July 4, 1997 (received for review May 6, 1997)

Recent evolution of TB bacilli

ABSTRACT One-third of humans are infected with Mycobacterium tuberculosis, the causative agent of tuberculosis. Sequence analysis of two megabases in 26 structural genes or loci in strains recovered globally discovered a striking reduction of silent nucleotide substitutions compared with other human bacterial pathogens. The lack of neutral mutations in structural genes indicates that M. tuberculosis is evolutionarily young and has recently spread globally. Species diversity is largely caused by rapidly evolving insertion sequences, means that mobile element movement is a fundamental process generating genomic variation in this pathogen. Three genetic groups of M. tuberculosis were identified based on two polymorphisms that occur at high frequency in the genes encoding catalase-peroxidase and the A subunit of gyrase. Group 1 organisms are evolutionarily old and allied with M. bovis, the cause of bovine tuberculosis. A subset of several distinct insertion sequence IS6110 subtypes of this genetic group have IS6110 integrated at the identical chromosomal insertion site, located between dnaA and dnaN in the region containing the origin of replication. Remarkably, study of approximately 6,000 isolates from patients in Houston and the New York City area discovered that 47 of 48 relatively large case clusters were caused by genotypic group 1 and 2 but not group 3 organisms. The observation that the newly emergent group 3 organisms are associated with sporadic rather than clustered cases suggests that the pathogen is evolving toward a state of reduced transmissability or virulence.

slide4

Genomics of tubercle bacilli

M. tuberculosis complex

M. microti

M. tuberculosis

M. africanum

M. bovis

M. bovis BCG

M. canettii

H37Rv

CDC1551

K- strain

Shotgun

Shotgun

Shotgun

finished

AF2122/97

BCG-Pasteur

4.32 Mb

4.31Mb

4.41 Mb

Finished

In progress

slide5

Genome of M. tuberculosis

4,000 genes

40%

orphans

Maps of

other spp.

nearly identical

Cole et al. (1998)

Nature 393: 537-544

sources of genetic diversity
Sources of genetic diversity

PZA-R

  • Point mutations or SNP
  • InDels
  • Insertions: IS, gene dup, HT,

replication errors

  • Deletions: RecA, IS-mediated,

replication errors

  • Translocations

IS6110, BCG

Common, RD

None to date

comparative genomic statistics
Comparative genomic statistics

InDels drive plasticity

TbD1: Major region of difference between Mt & Mb

Garnier et al. (2003) PNAS 100:7877

tbd1 truncates mmpl6
TbD1 truncates MmpL6

∆ M. tuberculosis

Might affect

lipid/glycolipid

export

slide10

cobL

Rv2073c

Rv2074

Rv2075c

M. tuberculosis

AAATTACTGTGGCCCTGCGCAA....

..TTGGTGGCACGCCGGGCCGG

AAATTACTGTGGCCCACGCCGGGCCGG

M. africanum

M. microti

M. bovis

BCG

RD9 - an ancient deletion

Cannot be due

to insertion

slide11

RvD2 - a recent deletion

M. bovis

Rv1758

RvD2-ORF2

RvD2-ORF3

plcD

RvD2-ORF1

M. tuberculosis

H37Ra

IR

Rv1758 ’

RvD2-ORF2

IR

RvD2-ORF3

Rv1758 ’

IS6110

IS6110

IS6110

plcD ’

plcD’

RvD2-ORF1

IS6110

IR

IR

Rv1758 ’

D

AGC

GAG

Rv1758 ’

Less

informative

M. tuberculosis

H37Rv

IR

IS6110

IS6110

plcD ’

IR

GAG

AGC

slide12

RD9 is

here!

RD regions in M. tb complex

slide13

RD 9

RD 7

RD 8

RD 10

RD 9

RD 9

RD 7

RD 8

RD10

RD 4

RD 5

RD12

RD13

RD3 (F Rv1)

RD 5’

RD3 (F Rv1)

RD distribution in M. tbc

M. bov.

M. mic.

M. can.

M. tub.

M. afri.

BCG

TbD1

RD 12’

RD 9

RD 7

RD 8

RD10

RD 4

RD 5

RD12

RD13

RD 1

RD 2

RD11 (F Rv2)

RD3 (F Rv1)

RD11 (F Rv2)

slide14

Evolutionary scenario

RDcan

M. canettii

Numerous sequence

polymorphisms

“ancestral”

TbD 1

RD 9

Common ancestor of the

M. tuberculosis complex

M. tuberculosis

“modern”

katG 463 CTGCGG

gyrA95AGCACC

RD 7

RD 8

RD 10

M. africanum

mmpL6 551AACAAG

RDmic

M. microti

RDseal

seal-isol.

oxyR 285 GA

RD 12

oryx-isol.

RD 13

Brosch et al.2002

Proc Natl Acad Sci U S A.

99:3684-9.

goat-isol.

pncA 57CACGAC

RD 4

M. bovis

“classical”

RD 1

BCG Tokyo

RD 2

RD 14

BCG Pasteur

slide15

Rapid ID of TB bacilli

RDcan

M. canettii

“ancestral”

TbD 1

RD 9

M. tub.

katG 463 CTGCGG

“modern”

RD9+

gyrA 95AGCACC

RD 7

RD 8

RD 10

M. africanum

mmpL6 551AACAAG

RDmic

M. microti

RDseal

seal

oxyR 285 GA

RD 12

oryx

RD 13

goat

pncA57CACGAC

RD 4

M. bovis

“classical”

RD 1

BCG Tokyo

RD 2

RD 14

BCG Pasteur

slide16

RDcan

M. canettii

“ancestral”

TbD 1

eg. Beijing cluster

RD 9

“modern”

katG 463 CTGCGG

eg. Haarlem cluster

M. tub.

RD9+

gyrA 95AGCACC

eg. H37Rv

RD 7

RD 8

TbD1-

RD 10

M. africanum

mmpL6 551AACAAG

RDmic

M. microti

RDseal

seal

oxyR n285 GA

RD 12

oryx

RD 13

pncAc57CACGAC

goat

RD 4

M. bovis

“classical”

RD 1

BCG Tokyo

RD 2

RD 14

BCG Pasteur

Rapid ID of TB bacilli

slide17

RDcan

M. canettii

“ancestral”

TbD 1

RD 9

M. tub.

katG 463 CTGCGG

“modern”

RD9-

gyrA 95AGCACC

RD 7

RD 8

RD 10

M. africanum

mmpL6 551AACAAG

RDmic

M. microti

RDseal

seal-isolates

oxyR n285 GA

RD 12

oryx-isolates

RD 13

goat-isolates

pncAc57CACGAC

RD 4

M. bovis

“classical”

RD 1

BCG Tokyo

RD 2

BCG Pasteur

RD 14

Rapid ID of TB bacilli

slide18

RDcan

M. canettii

“ancestral”

TbD 1

RD 9

M. tub.

katG 463 CTGCGG

“modern”

RD9-

gyrA 95AGCACC

RD 7

mmpL6 551 AAG

RD 8

RD 10

M. africanum

mmpL6 551AACAAG

RDmic

M. microti

RDseal

seal-isolates

oxyR n285 GA

RD 12

oryx-isolates

RD 13

goat-isolates

pncA 57CACGAC

RD 4

M. bovis

“classical”

RD 1

BCG Tokyo

RD 2

BCG Pasteur

RD 14

Rapid ID of TB bacilli

slide19

RDcan

M. canettii

“ancestral”

TbD 1

RD 9

M. tub.

katG 463 CTGCGG

“modern”

RD9-

gyrA 95AGCACC

RD 7

RD 8

RD4-

RD 10

M. africanum

mmpL6 551AACAAG

RDmic

M. microti

RDseal

seal

oxyR n285 GA

RD 12

oryx

RD 13

goat

pncA 57CACGAC

RD 4

M. bovis

“classical”

RD 1

BCG Tokyo

RD 2

RD 14

BCG Pasteur

Rapid ID of TB bacilli

slide20

RDcan

M. canettii

“ancestral”

TbD 1

RD 9

M. tub.

katG 463 CTGCGG

“modern”

RD9-

gyrA 95AGCACC

RD 7

RD1-

RD 8

RD 10

M. africanum

mmpL6 551AACAAG

RDmic

M. microti

RDseal

seal

oxyR n285 GA

RD 12

oryx

RD 13

goat

pncA 57CACGAC

RD 4

M. bovis

“classical”

RD 1

RD 2

RD 14

BCG

Rapid ID of TB bacilli

slide21

Evolution of the M. tb complex

M. bovis

X

M. tuberculosis

slide22

Evolution of the M. tb complex

M. bovis

M. tuberculosis

Progenitor bacillus

has m tb evolved since

Has M. tb evolved since?

Different approaches to population genetics

All based on genomics

slide24

Mycobacterium canettii issmooth

M. canettii

M. tuberculosis

slide25

M. prototuberculosis

Split decomposition analysis, SNP data

MTBC

(worldwide)

M. canettii

Smooth tubercle

bacilli

(Djibouti, East Africa)

slide26

LSP (RD) typing

Gagneux et al. (2006) Variable host-pathogen compatibility in M. tuberculosis. Proc Natl Acad Sci

U S A; 103: 2869-2873.

slide27

SNP typing - 1

Baker et al. (2004)

Silent nucleotide polymorphisms and

a phylogeny for Mycobacterium tuberculosis.

Emerg Infect Dis 2004; 10: 1568-77.

Examined 37 sSNPs

in 225 isolates

slide28

SNP typing - 2

36 sSNPs

in 5069 isolates

Gutacker et al. (2006) Single-nucleotide polymorphism-based population genetic analysis of Mycobacterium tuberculosis strains from 4 geographic sites. J Infect Dis; 193: 121-128.

slide29

SNP typing - 3

Studied 159 sSNPs

in 219 isolates

slide30

Global distribution

Red Euro-American

Green W-African 1

Brown W-African 2

Yellow Indo-Oceanic

Purple EA-Indian

Blue East Asian

Blue is most

worrying

the beijing family

The Beijing family

Appears to be more virulent, more transmissible & associated with MDR

TRENDS in Microbiology

Vol.10 No.1 January 2002

45-52

beijing phylogeny

Beijing phylogeny

Marmiesse et al. (2004)

Microbiology 150: 483 - 496

a new lipid pgl in beijing

A new lipid - PGL - in Beijing

Reed et al. (2004) Nature 431: 84-87

immunologic effects of pgl

Immunologic effects of PGL

Reed et al. (2004) Nature 431: 84-87

further immunologic effects

Further immunologic effects

Single sugar accounts for difference

Reed et al. (2004) Nature 431: 84-87

pgl impacts on phenotype

PGL impacts on phenotype

  • Increases lethality greatly but not bacterial load
  • Down-regulates pro-inflammatory response in dose-dependent manner
  • Represses TNF-alpha, IL-6 & IL-12 production
  • May contribute to increased transmission

Reed et al. (2004) Nature 431: 84-87

summary

Summary

  • M. tuberculosis complex tightly knit but differences

in host range

  • M. tuberculosis not descended from M. bovis

but possibly from M. prototuberculosis

  • Species became host adapted. 4-5 major M.tb groups
  • Hypervirulent variants emerge and replace

existing clones

slide39

With the participation of...

Institut Pasteur

R. Brosch

S. Brisse

M-C. Gutierrez

T. Garnier

N. Honoré

M. Marmiesse

V. Vincent

WT Sanger Institute

B.G. Barrell

J. Parkhill

M-A. Rajandream

NIH

NIAID

ILEP

Central Veterinary Lab.

R.G. Hewinson

S.V. Gordon