slide1 l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Detection of QTL in beef cattle Eduardo Casas U.S. Meat Animal Research Center, Clay Center, Nebraska PowerPoint Presentation
Download Presentation
Detection of QTL in beef cattle Eduardo Casas U.S. Meat Animal Research Center, Clay Center, Nebraska

Loading in 2 Seconds...

play fullscreen
1 / 32

Detection of QTL in beef cattle Eduardo Casas U.S. Meat Animal Research Center, Clay Center, Nebraska - PowerPoint PPT Presentation


  • 218 Views
  • Uploaded on

Detection of QTL in beef cattle Eduardo Casas U.S. Meat Animal Research Center, Clay Center, Nebraska. DNA structure. Cell. Chromosome. Nucleosome. Double helix. Sequence. Microsatellites and Single Nucleotide Polymorphisms. Microsatellites. SNP. Alelle A. GAACT A GCTTGAC.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Detection of QTL in beef cattle Eduardo Casas U.S. Meat Animal Research Center, Clay Center, Nebraska' - Olivia


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

Detection of QTL in beef cattle

Eduardo Casas

U.S. Meat Animal Research Center,

Clay Center, Nebraska

slide2

DNA structure

Cell

Chromosome

Nucleosome

Double helix

Sequence

slide3

Microsatellites and Single Nucleotide Polymorphisms

Microsatellites

SNP

Alelle A

GAACTAGCTTGAC

CCGTATCACACAGTCAAC

Alelle B

CCGTATCACACACACAGTCAAC

GAACTGGCTTGAC

slide4

Microsatellites

Dam

1

2

3

4

5

8

10

11

Sire

Dam allele 1

Sire allele 1

Sire allele 2

Dam allele 2

slide5

Bovine

Chromosome 2

(BTA2).

(Kappes et al., 1997)

slide9

Identification of QTL in cattle

What have we used to identify QTL?

What have we found?

Where are we validating them?

slide14

¼ Hereford

¼ Angus

¼ Pinzgauer

¼ Red Poll

MARC III

http://www.ansi.okstate.edu/breeds/index.htm

slide15

Traits measured

Growth traits:

- Birth weight (kg).

- Weaning weight (kg).

- Yearling weight (kg).

- Postweaning average

daily gain (kg/d).

  • Measured carcass traits:
  • - Hot carcass weight (kg).
  • - Fat depth (cm).
  • - Marbling score.
  • - Longissimus muscle area (cm2).
  • - USDA yield grade.
  • Est. kidney, pelvic, & heart fat (%).
  • Rib bone.
  • Ribfat.
  • - Ribmus.
  • - Warner-Bratzler shear force
  • 2 or 3 d postmortem (kg).
  • - Warner-Bratzler shear force
  • 14 d postmortem (kg).

Predicted carcass traits:

- Retail product yield (%).

- Fat yield (%).

- Bone yield (%).

- Dressing percent (%).

slide16

Identification of QTL in cattle

What have we used to identify QTL?

What have we found?

Where are we validating them?

slide17

GENOME SCAN RESULTS IN ALL RESOURCE FAMILIES

BM

Blackie

Bonzo

PA

BTA1

BTA2

BTA3

BTA4

BTA5

MSTN

WBS14

RPYD, FATYD

FAT, YG, RPYD, WBS14

RIBBONE, DP, RIBFAT, BWT

RPYD

FATYD

MARB, RPYD

MARB

MARB, RPYD

MARB, RPYD

Fat yield

HCW, WBS3

BTA6

BTA8

BTA15

BTA27

BTA29

FAT, MARB

FAT

BWT, W365,

HCW, LMA

WBS14

WBS3, WBS14, Calpain

MARB

Dairy Form

slide18

Identification of QTL in cattle

What have we used to identify QTL?

What have we found?

Where are we validating them?

slide19

25 % Piedmontese

75 % Piedmontese

50% Piedmontese

Germplasm Evaluation, Cycle IV

Dam line

(n = 71)

(n = 109)

Sire line

(n= 6) 52 -------

(n= 7) ------- 96

(n= 35) 35 41

PH

(n= 5) 52 -------

PA

(n= 5) ------- 47

Total

(n= 6) 117 184

slide20

Germplasm Evaluation, Cycle V

Dam:

Hereford

MARC III

Angus

F1

BB(F1)

Ch(F1)

n = 1551 (from 1998 to 1999)

(Cundiff et al., 1998, 1999, 2000)

slide21

Germplasm Evaluation, Cycle V

F2 subpopulation

n = 154 (from 1998 to 1999)

(Cundiff et al., 1998, 1999, 2000)

slide22

Germplasm Evaluation, Cycle VI

Dam:

Hereford

MARC III

Angus

Sire:

Hereford

Angus

Wagyu

Norwegian Red

Swedish Red & White

Friesian

F1

(N= 415)

Ch(F1)

n = 820 (from 2001 to 2002)

(Cundiff et al., 1998, 1999, 2000)

slide23

Germplasm Evaluation, Cycle VII

Sire:

Hereford,

Angus,

Red Angus,

Limousin,

Charolais,

Simmental,

Gelbvieh

Dam:

Hereford

MARC III

Angus

F1

n = 1400

(from 1999 to 2001)

Approximately 600/year

(from 2003 and on)

F2

(Cundiff et al., 1998, 1999, 2000)

slide24

Germplasm Evaluation, Cycle VIII

Sire:

Hereford

Angus

Beefmaster

Brangus

Bonsmara

Romosinuano

Dam:

Hereford

MARC III

Angus

F1

n = 1200

(from 2001 to 2002)

Terminal cross

(Approximately 600/year)

(Cundiff et al., 1998, 1999, 2000)

slide25

STARS Brahman cattle project

504 offspring samples obtained from 1995 to 1999

(Riley et al., 2002)

calving ease selection ce
Calving Ease Selection (CE)

Heifer

Calving

Difficulty

Birth

Weight

EBV, lb

slide27

PA

GPE IV

BM

GPE V

Characterization of the variation of Myostatin (BTA2)

in resource populations.

slide28

BH

PA

FAT, WBS14, and YG

GPE VII

REA, Marbling, FATYD

Characterization of variation for QTL on BTA5 for

carcass traits in resource populations.

slide29

BWT, WWT,

LWT, ADG,

HCW, and REA

BM

GPE VII

Characterization of variation for QTL on BTA6 for

growth and carcass traits in resource populations.

slide30

BM

GPE VII

MARBLING

Characterization of variation for QTL on BTA27 for

marbling in resource populations.

slide31

BH

PA

Tenderness

GPE VII

Tenderness

Tenderness

STARS

Tenderness

Characterization of variation for QTL on BTA29 for

meat tenderness in resource populations.

slide32

Blackie

Bonzo

GPE VI

GPE IV

GPE V

GPE VII

GPE VIII

Calving

Ease

STARS

Characterization of QTL variation in resource populations.

PA

BM