genetic technologies l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Genetic Technologies PowerPoint Presentation
Download Presentation
Genetic Technologies

Loading in 2 Seconds...

play fullscreen
1 / 101

Genetic Technologies - PowerPoint PPT Presentation


  • 240 Views
  • Uploaded on

Genetic Technologies. http://www.stats.gla.ac.uk/~paulj/tech_genetics.ppt. Overview. Why learn about genetic technologies? The molecular geneticist’s toolkit Genetic markers Microarray assays Telomeres RNA interference (RNAi). Why learn about genetic technologies?.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Genetic Technologies' - Faraday


Download Now An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
genetic technologies

Genetic Technologies

http://www.stats.gla.ac.uk/~paulj/tech_genetics.ppt

overview
Overview
  • Why learn about genetic technologies?
  • The molecular geneticist’s toolkit
  • Genetic markers
  • Microarray assays
  • Telomeres
  • RNA interference (RNAi)
why learn about genetic technologies4
Why learn about genetic technologies?

We need to understand the processes that generated the data

  • Understanding of biology obviously necessary
  • Understanding of lab techniques will enhance our ability to assess data reliability
  • Errors in any measurement can lead to loss of power or bias
  • Some genetic analyses are particularly sensitive to error because
    • they depend on the level of identity between DNA sequences shared by relatives
    • the more data is collected, the greater the chance of false differences
why learn about genetic technologies5
Why learn about genetic technologies?
  • What is the probability that the observed genotype is wrong?
  • Is this probability the same for all observed genotypes?
  • What impact will a realistic range of errors have on power?

Individual

Genotype

A

177, 179

B

179, 179

most genetic technologies are based on four properties of dna
Most genetic technologies are based on four properties of DNA
  • DNA can be cut at specific sites (motifs) by restriction enzymes
  • Different lengths of DNA can be size-separated by gel electrophoresis
  • A single strand of DNA will stick to its complement (hybridisation)
  • DNA can copied by a polymeraseenzyme
    • DNA sequencing
    • Polymerase chain reaction (PCR)
dna can be cut at specific sites motifs by an enzyme

Sau3AI

GATC

CTAG

DNA can be cut at specific sites (motifs)by an enzyme
  • Restrictionenzymes cut double-stranded DNA at specific sequences (motifs)
  • E.g. the enzyme Sau3AI cuts at the sequence GATC
  • Most recognition sites are palindromes: e.g. the reverse complement of GATC is GATC
  • Restriction enzymes evolved as defence against foreign DNA
dna can be cut at specific sites motifs by an enzyme9
DNA can be cut at specific sites (motifs)by an enzyme

ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT

TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA

dna can be cut at specific sites motifs by an enzyme10

Sau3AI

GATC

CTAG

DNA can be cut at specific sites (motifs)by an enzyme

ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT

TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA

dna can be cut at specific sites motifs by an enzyme11

Sau3AI

GATC

CTAG

DNA can be cut at specific sites (motifs)by an enzyme

ACTGTCGATGTCGTCGTCGTAGCTGCT GATCGTAGCTAGCT

TGACAGCTACAGCAGCAGCATCGACGACTAG CATCGATCGA

dna can be cut at specific sites motifs by an enzyme12
DNA can be cut at specific sites (motifs)by an enzyme

ACTGTCGATGTCGTCGTCGTAGCTGCT

TGACAGCTACAGCAGCAGCATCGACGACTAG

GATCGTAGCTAGCT

CATCGATCGA

ACTGTCGATGTCGTCGTCGTAGCTGCTGA

TGACAGCTACAGCAGCAGCATCGACGACT

TCGTAGCTAGCT

AGCATCGATCGA

different lengths of dna can be separated by gel electrophoresis
Different lengths of DNA can be separated by gel electrophoresis
  • DNA is negatively charged and will move through a gel matrix towards a positive electrode
  • Shorter lengths move faster
different lengths of dna can be separated by gel electrophoresis14
Different lengths of DNA can be separated by gel electrophoresis
  • DNA is negatively charged and will move through a gel matrix towards a positive electrode
  • Shorter lengths move faster
different lengths of dna can be separated by gel electrophoresis15

S

M

F

Different lengths of DNA can be separated by gel electrophoresis

Slow: 41 bp

ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT

TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA

Medium: 27 bp

ACTGTCGATGTCGTCGTCGTAGCTGCT

TGACAGCTACAGCAGCAGCATCGACGACTAG

Fast: 10 bp

GATCGTAGCTAGCT

CATCGATCGA

different lengths of dna can be separated by gel electrophoresis16

DD

HH

HD

S

M

F

Different lengths of DNA can be separated by gel electrophoresis

Recessive disease allele D is cut by Sma3AI:

ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT

TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA

Healthy H allele is not cut:

ACTGTCGATGTCGTCGTCGTAGCTGCTGAGCGTAGCTAGCT

TGACAGCTACAGCAGCAGCATCGACGACTCGCATCGATCGA

a single strand of dna will stick to its complement
A single strand of DNA will stick to its complement

ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT

TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA

a single strand of dna will stick to its complement19
A single strand of DNA will stick to its complement

60°C

ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT

TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA

a single strand of dna will stick to its complement20
A single strand of DNA will stick to its complement

95°C

ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT

TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA

a single strand of dna will stick to its complement21
A single strand of DNA will stick to its complement

60°C

ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT

TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA

a single strand of dna will stick to its complement22
A single strand of DNA will stick to its complement

Fragment frequency

Flourescence

Fragment length in bp

a single strand of dna will stick to its complement24
A single strand of DNA will stick to its complement

Southern blotting (named after Ed Southern)

a single strand of dna will stick to its complement25
A single strand of DNA will stick to its complement

Southern blotting (named after Ed Southern)

dna can copied by a polymerase enzyme
DNA can copied by a polymerase enzyme

ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT

TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA

dna can copied by a polymerase enzyme30

DNA polymerase

DNA can copied by a polymerase enzyme

ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT

TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA

A

G

T

G

C

A

A

G

C

T

G

G

A

A

G

A

G

T

T

C

T

C

C

C

A

G

T

A

A

G

dna can copied by a polymerase enzyme31

DNA polymerase

DNA can copied by a polymerase enzyme

ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT

TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA

A

G

T

G

C

A

A

G

C

T

G

G

A

A

G

A

G

T

T

C

T

C

C

C

A

G

T

A

A

G

dna can copied by a polymerase enzyme33
DNA can copied by a polymerase enzyme

ACTGT

ACTGTCGAT

ACTGTCGATGT

ACTGTCGATGTCGT

ACTGTCGATGTCGTCGT

ACTGTCGATGTCGTCGTCGT

ACTGTCGATGTCGTCGTCGTAGCT

ACTGTCGATGTCGTCGTCGTAGCTGCT

ACTGTCGATGTCGTCGTCGTAGCTGCTGAT

ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGT

ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCT

ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT

dna can copied by a polymerase enzyme34
DNA can copied by a polymerase enzyme

ACTGTCGATGT

ACTGTCGATG

ACTGTCGAT

ACTGTCGA

ACTGTCG

ACTGTC

ACTGT

T

G

T

A

G

C

T

Time

Fluorescence

T C G A T G T etc

Fluorescence

Time

dna can copied by a polymerase enzyme38
DNA can copied by a polymerase enzyme

Polymerase chain reaction (PCR)

  • A method for producing large (and therefore analysable) quantities of a specific region of DNA from tiny quantities
  • PCR works by doubling the quantity of the target sequence through repeated cycles of separation and synthesis of DNA strands
dna can copied by a polymerase enzyme40

Heat resistant DNA polymerase

Forward primer

Reverse primer

G, A, C, T bases

DNA template

A thermal cycler (PCR machine)

DNA can copied by a polymerase enzyme

G

A

C

T

dna can copied by a polymerase enzyme44
DNA can copied by a polymerase enzyme

In the words of its inventor, Kary Mullis…

  • PCR can generate 100 billion copies from a single DNA molecule in an afternoon
  • PCR is easy to execute
  • The DNA sample can be pure, or it can be a minute part of an extremely complex mixture of biological materials
  • The DNA may come from
    • a hospital tissue specimen
    • a single human hair
    • a drop of dried blood at the scene of a crime
    • the tissues of a mummified brain
    • a 40,000-year-old wooly mammoth frozen in a glacier.
the molecular geneticist s toolkit46
The molecular geneticist’s toolkit
  • Specific DNA-cutting restriction enzymes
  • DNA size separation by gel electrophoresis
  • Hybridisation using labelled DNA probes
  • Synthesis of DNA using DNA polymerase (PCR)
genetic markers48
Genetic markers
  • What are they?
    • Variable sites in the genome
  • What are their uses?
    • Finding disease genes
    • Testing/estimating relationships
    • Studying population differences
the ideal genetic marker
The ideal genetic marker
  • Codominant
  • High diversity
  • Frequent across whole genome
  • Easy to find
  • Easy to assay
modern genetic markers snps
Modern genetic markers: SNPs
  • SNPs are single nucleotide polymorphisms
  • Usually biallelic, and one allele is usually rare
  • Can be protein-coding or not
  • This example is a T/G SNP. An individual can be TT, TG, GG

Healthy allele A is cut by Sma3AI:

ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT

TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA

Recessive disease B allele is not cut:

ACTGTCGATGTCGTCGTCGTAGCTGCTGAGCGTAGCTAGCT

TGACAGCTACAGCAGCAGCATCGACGACTCGCATCGATCGA

modern genetic markers snps53
Modern genetic markers: SNPs

Allele-specific oligonucleotide

OLA: oligonucleotide ligation assay

Clin Biochem Rev (2006) 27: 63–75

modern genetic markers snps56
Modern genetic markers: SNPs

Clin Biochem Rev (2006) 27: 63–75

modern genetic markers snps57
Modern genetic markers: SNPs

ARMS: amplification refractory mutation system

Clin Biochem Rev (2006) 27: 63–75

modern genetic markers snps58
Modern genetic markers: SNPs

OLA: oligonucleotide ligation assay

Clin Biochem Rev (2006) 27: 63–75

modern genetic markers snps59
Modern genetic markers: SNPs

Molecular beacon probes

Clin Biochem Rev (2006) 27: 63–75

modern genetic markers snps60
Modern genetic markers: SNPs

Pyrosequencing

Clin Biochem Rev (2006) 27: 63–75

modern genetic markers microsatellites
Modern genetic markers: microsatellites
  • Microsatellites are short tandem repeats (STR, also SSR)
  • Usually high diversity
  • Usually not in protein coding sequence
  • This example is an (AC)n repeat; a genotype is usually written n,n
  • With k alleles there are k(k+1)/2 possible unordered genotypes

ACTGTCGACACACACACACACGCTAGCT (AC)7

TGACAGCTGTGTGTGTGTGTGCGATCGA

ACTGTCGACACACACACACACACGCTAGCT (AC)8

TGACAGCTGTGTGTGTGTGTGTGCGATCGA

ACTGTCGACACACACACACACACACACGCTAGCT (AC)10

TGACAGCTGTGTGTGTGTGTGTGTGTGCGATCGA

ACTGTCGACACACACACACACACACACACACGCTAGCT (AC)12

TGACAGCTGTGTGTGTGTGTGTGTGTGTGTGCGATCGA

uses of snps and microsatellites
Uses of SNPs and microsatellites
  • SNPs
    • The HapMap project has discovered millions of SNPs
    • Their high density in the genome makes them ideal for association studies, where markers very close to disease genes are required
  • Microsatellites
    • More suitable for family-based studies, where high variation is valuable and lower levels of resolution are required
overview68
Overview
  • Why learn about genetic technologies?
  • The molecular geneticist’s toolkit
  • Genetic markers
  • Microarrays
  • Telomeres
  • RNA interference (RNAi)
the molecular geneticist s toolkit69
The molecular geneticist’s toolkit
  • Specific DNA-cutting restriction enzymes
  • DNA size separation by gel electrophoresis
  • Hybridisation using labelled DNA probes
  • Synthesis of DNA using DNA polymerase (PCR)
overview70
Overview
  • Why learn about genetic technologies?
  • The molecular geneticist’s toolkit
  • Genetic markers
  • Microarrays
  • Telomeres
  • RNA interference (RNAi)
gene expression
Gene expression
  • Transcription:
    • DNA gene → mRNA
    • in nucleus
  • Translation:
    • mRNA → protein
    • in cytoplasm
  • Microarrays use mRNA as a marker of gene expression

Nucleus

Cytoplasm

what are microarrays
What are microarrays?
  • A microarray is a DNA “chip” which holds 1000s of different DNA sequences
  • Each DNA sequence might represent a different gene
  • Microarrays are useful for measuring differences in gene expression between two cell types
  • They can also be used to study chromosomal aberrations in cancer cells
principles behind microarray analysis
Principles behind microarray analysis
  • Almost every body cell contains all ~25,000 genes
  • Only a fraction is switched on (expressed) at any time in any cell type
  • Gene expression involves the production of specific messenger RNA (mRNA)
  • Presence and quantity of mRNA can be detected by hybridisation to known RNA (or DNA) sequences
what can microarray analysis tell us
What can microarray analysis tell us?
  • Which genes are involved in
    • disease?
    • drug response?
  • Which genes are
    • switched off/underexpressed?
    • switched on/overexpressed?
before microarrays northern blotting
Before microarrays: northern blotting
  • Extract all the mRNA from a cell
  • Size-separate it through a gel
  • Measure level of expression using a probe made from your gene of interest
microarrays can be used to diagnose and stage tumours and to find genes involved in tumorigenesis
Microarrays can be used to diagnose and stage tumours, and to find genes involved in tumorigenesis
  • Copy number changes are common in tumours
  • Loss or duplication of a gene can be a critical stage in tumour development

Chromosome 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 202122

BMC Cancer 2006, 6:96

problems of microarray analysis
Problems of microarray analysis
  • Gene expression ≠ mRNA concentration
  • Easy to do, difficult to interpret
  • Standardisation between labs
  • Lots of noise, lots of genes (parameters)
    • e.g. p = 10,000
  • low sample size
    • e.g. n = 3
telomeres and telomerase
Telomeres and telomerase

Telomere

  • Telomeres are repetitive DNA sequences at the ends of chromosomes
  • They protect the ends of the chromosome from DNA repair mechanisms
  • In somatic cells they shorten at every cell division, leading to aging
  • In germ cells they are re-synthesised by the enzyme telomerase

Centromere

Telomere

why do we need telomeres
Why do we need telomeres?
  • At every cell division each chromosome must be replicated
  • DNA is synthesised in one direction only
  • The “lagging strand” is synthesised “backwards” in 100–200 bp chunks
leading strand
Leading strand
  • This isn’t a problem for the leading strand…
lagging strand
Lagging strand
  • …but 100–200 bp of single stranded DNA are left hanging at the end of the lagging strand, and are lost.
health implications of telomere shortening cancer
Health implications of telomere shortening: cancer
  • Cancer tumour cells divide excessively, and will die unless they activate telomerase
  • Telomerase activation is an important step in many cancer cell types
  • Telomere length can be used to diagnose tumours
  • Telomerase is a potential target of cancer therapy
measuring telomeres
Measuring telomeres
  • Two principal methods

Southern blotting Quantitative PCR (qPCR)

what is rnai
What is RNAi?
  • Generally genes are studied through the effects of knockout mutations in particular experimental organisms
  • RNAi is a quick and easy technique for reducing gene function without the necessity of generating mutants that can be applied to any organism
  • It has the potential to treat diseases caused by over-expression of genes
principles of rna interference rnai
Principles of RNA interference (RNAi)
  • Injection of double-stranded RNA (dsRNA) complementary to a gene silences gene expression by
    • destruction of mRNA
    • transcriptional silencing
    • stopping protein synthesis
  • Gene expression can be switched off in specific tissues or cells by the injection of specific dsRNA
uses of rnai
Uses of RNAi
  • Investigating role of genes by knocking down (not out) gene expression in specific tissues at specific developmental stages
  • Potential use in gene therapy
    • macular degeneration: two phase I trials currently under way
    • therapies being developed for HIV, hepatitis, cancers
limitations of rnai
Limitations of RNAi
  • Target specificity: how do you know the dsRNA isn’t interfering with other genes?
    • Interpretation of results
    • Risks for gene therapy
  • Function isn’t knocked out, it’s reduced
    • Knockdown may not reveal gene function
    • Might not give therapeutic effect