Ch 12 4 mutations
Download
1 / 14

Ch. 12.4 Mutations - PowerPoint PPT Presentation


  • 233 Views
  • Uploaded on

Ch. 12.4 Mutations. Section Objectives: Categorize the different kinds of mutations that can occur in DNA. Compare the effects of different kinds of mutations on cells and organisms. Mutations. Any change in DNA sequence is called a mutation .

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Ch. 12.4 Mutations' - zared


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Ch 12 4 mutations l.jpg

Ch. 12.4 Mutations

Section Objectives:

Categorize the different kinds of mutations that can occur in DNA.

Compare the effects of different kinds of mutations on cells and organisms.


Mutations l.jpg
Mutations

  • Any change in DNA sequence is called a mutation.

  • can be caused by errors in replication, transcription, cell division, or by external agents.

  • If mutation occurs in gametes (sex cells) it will be passed on to offspring

  • may produce a new trait or it may result in a protein that does not work correctly.

    the mutation results in a protein that is nonfunctional, and the embryo may not survive

    In some rare cases a gene mutation may have positive effects.


Mutations3 l.jpg
Mutations

  • If mutation takes place in a body cell, it is not passed on to organism’s offspring

    • Damage to a gene may impair the function of the cell

    • When that cell divides, the new cells also will have the same mutation

    • Some mutations of DNA in body cells affect genes that control cell division.

    • This can result in the cells growing and dividing rapidly, producing cancer.


Mutations4 l.jpg

TACGCACATTTACGTACG

DNA

aa

aa

aa

aa

aa

aa

aa

AUGCGUGUAAAUGCAUGC

mRNA

protein

trait

Mutations

  • Changes to DNA are called mutations

    • change the DNA

    • changes the mRNA

    • may change protein

    • may change trait


Types of mutations l.jpg
Types of mutations

  • Changes to the letters (A,C,T,G bases) in the DNA

    • point mutation

      • change to ONE letter (base) in the DNA

      • may cause change to protein, may not

    • frameshift mutation

      • addition of a new letter (base) in the DNA sequence

      • deletion of a letter (base) in the DNA

      • both of these shift the DNA so it changes how the codons are read

      • big changes to protein!


Point mutations l.jpg
Point Mutations

  • One base change

    • can change the meaning of the whole protein

THEFATCATANDTHEREDRATRAN

Does this changethe sentence?

A LITTLE!

THEFATCARANDTHEREDRATRAN

OR

THEFATCATENDTHEREDRATRAN


Point mutations7 l.jpg
Point Mutations

  • Missense mutation = changes amino acid

AUGCGUGUAUACGCAUGCGAGUGA

MetArgValTyrAlaCysGluStop

Doesthis changethe protein?

DEPENDS…

AUGCGUGUAUACGUAUGCGAGUGA

MetArgValTyrValCysGluStop


Sickle cell anemia l.jpg
Sickle cell anemia

  • Hemoglobin protein in red blood cells

    • strikes 1 out of 400 African Americans

    • limits activity, painful & may die young

Normalround cells

Misshapensickle cells

Only 1 out of146 amino acids


Point mutations9 l.jpg
Point Mutations

  • Silent mutation = no change to protein

AUGCGUGUAUACGCAUGCGAGUGA

MetArgValTyrAlaCysGluStop

Does this changethe protein?

Why not?

The code hasrepeats in it!

AUGCGUGUAUACGCUUGCGAGUGA

MetArgValTyrAlaCysGluStop


Point mutations10 l.jpg
Point Mutations

  • Nonsense mutation = change to STOP

AUGCGUGUAUACGCAUGCGAGUGA

MetArgValTyrAlaCysGluStop

Really destroyedthat protein!

AUGCGUGUAUAAGCAUGCGAGUGA

MetArgValStop


Frameshift mutations l.jpg
Frameshift Mutations

  • Add or delete one or more bases

    • changes the meaning of the whole protein

THEFATCATANDTHEREDRATRAN

Does this changethe sentence?

A LOT!

Delete one!

Add one!

THEFATCANTANDTHEREDRATRAN

OR

THEFATCAANDTHEREDRATRAN


Frameshift mutations12 l.jpg
Frameshift Mutations

  • Addition = add one or more bases

AUGCGUGUAUACGCAUGCGAGUGA

MetArgValTyrAlaCysGluStop

Does this changethe protein?

A LOT!

AUGCGUGUAUACGUCAUGCGAGUGA

MetArgValTyrValMetArgValA


Frameshift mutations13 l.jpg
Frameshift Mutations

  • Deletion = lose one or more bases

AUGCGUGUAUACGCAUGCGAGUGA

MetArgValTyrAlaCysGluStop

Does this changethe protein?

A LOT!

AUGCGUGUAUACGAUGCGAGUGA

MetArgValTyrAspAlaSerGA


Causes of mutations l.jpg
Causes of Mutations

  • sometimes a mistake in base pairing during DNA replication.

  • many mutations are caused by factors in the environment

  • Any agent that can cause a change in DNA is called a mutagen.

    • Mutagens include radiation, chemicals, and even high temperatures


ad