Why is proper protein production so important?
This presentation is the property of its rightful owner.
Sponsored Links
1 / 34

Why is proper protein production so important? PowerPoint PPT Presentation


  • 39 Views
  • Uploaded on
  • Presentation posted in: General

Why is proper protein production so important?. Cystic Fibosis – most common genetic disease. Progeria. Porphyria. Achondrolplasia. Tay Sach’s. Sickle Cell Anemia. Developmental Abnormalities. Deoxyribose sugar ATGC are the bases Stable, immortal Double stranded 6 x 10 9 base pairs.

Download Presentation

Why is proper protein production so important?

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Why is proper protein production so important

Why is proper protein production so important?


Why is proper protein production so important

Cystic Fibosis – most common genetic disease

Progeria

Porphyria


Why is proper protein production so important

Achondrolplasia

Tay Sach’s

Sickle Cell Anemia


Developmental abnormalities

Developmental Abnormalities


Dna vs rna

Deoxyribose sugar

ATGC are the bases

Stable, immortal

Double stranded

6 x 109 base pairs

Ribose Sugar

AUGC are the bases

Unstable, short-lived

Single Stranded

Short pieces – made one gene at a time

DNA vs. RNA


Types of rna

Types of RNA

  • mRNA – flat, single chain (no secondary structure) – directs protein production

  • tRNA – shaped like a cloverleaf, matches nucleotides in the mRNA with the correct amino acids

  • rRNA makes up the ribosome – actually catalyzes peptide bond formation


Whole process of protein synthesis

Whole Process of Protein Synthesis

Transcription: making an mRNA copy of the DNA

Translation: matching up the mRNA with the right aa – so building the protein


Transcription making an mrna copy of one gene

Transcription – making an mRNA copy of one gene


Why is proper protein production so important

How do the transcription enzymes know where the beginning of each gene is and on what strand the gene is located?

  • The promoter is the beginning of the gene. It is a sequence of nucleotides where RNA polymerase binds to start transcription.

  • Every promoter has the sequence TATAAAA with ATATTTT on the opposite strand. This sequence is called the TATA box. This identifies the promoter.

  • The enzyme reads the non-TATA strand


Why is proper protein production so important

Since only some genes are read in each cell, how does it know which genes to read and when to read them?

  • Beside the TATA box, the promoter has other DNA sequences that are specific to that gene.

  • Specific transcription factors bind to those sequences

  • RNA polymerase can’t bind to naked DNA – it can only bind to a promoter if it already has transcription factors bound to it

  • Each cell only has certain transcription factors and sometimes only activates them when signaled to.


Dna mrna protein

Transcription

Translation

DNA → mRNA → Protein

Transcription:

  • An enzyme (RNA polymerase binds to DNA at the start of a gene called the promoter (TATA box – TATAAAA)

  • As the RNA polymerase binds, it opens the DNA and begins to move forward, adding matching complementary ribonucleotides. It can only go in 1 direction.

  • As the RNA polymerase moves forward, the DNA recoils behind it, pushing the single strand of RNA off. This continues until the termination sequence.

  • RNA gains no secondary structure


Practice

Practice

Give the mRNA transcript for the gene below:

[GGCTAGGCAATATAAAAGCTTGG]AAAATGCGGGAATTC

[CCGATCCGTTATATTTTCGAACC] TTTTACGCCCTTAAG

AAAAUGCGGGAAUUC

Copy the Non-TATA strand, don’t copy the promoter


Rna processing

RNA Processing

  • Cap is added to the front end – helps it leave the nucleus and bind to the ribosome, help protect the mRNA, and makes it go into the ribosome front first

  • Poly-A tail is added to the end (~200 A’s) – keeps mRNA from getting chewed up too fast

  • Splicing

    Splice out the introns, leave the exons

    Exons will actually code for the protein


Why is proper protein production so important

RNA Processing

DNA

Exon

Intron

Exon

Exon

Intron

Exon

Pre-mRNA

Cap-

Exon

Intron

Exon

Exon

Intron

Exon

-AAA

mRNA

Cap-

Exon

Exon

Exon

Exon

-AAA

Cytoplasm


Practice1

Practice:

Give the final mRNA as it would look before it enters the cytoplasm:

Stand #1: introns are red, exons are white

[GGGCGATATTTTCCATG]TAATGCTACGGAGGC/

AACGGG/CCCAAATAGTACAGC/CGAGAC/CCGATC

Strand #2:

[CCCGCTATAAAGGTAC]ATTACGATGCCTCCG/

TTGCCC/GGGTTTATCATGTCG/GCTCTG/GGCTAG

capAUUACGAUGCCUCCGGGGUUUAUCUGCGGCUAGtail


Explanation for practice answer

Explanation for practice answer

  • Reads non-TATA strand

  • Does not read the promoter

  • Adds complementary RNA nucleotides to match DNA nucleotides on the coding strand

  • Cuts out the introns after copying so not included in the final mRNA

  • A cap and a poly-A tail is added


Decoding translation

Decoding - Translation

Space A B C D E F G

0,0,0 1,2,3 4,5,6 7,8,9 10,11,12 13,14,15 16,17,18 19,20,21

H I J K L M N O

22,23,24 25,26,27 28,29,30 31,32,33 34,35,36 40,41,42 43,44,45 49,50,51

37,38,39 46,47,48 52,53,54

55,56,57

P Q R S T U V W

58,59,60 61,62,63 64,65,66 67,68,69 70,71,72 73,74,75 76,77,78 79,80,81

X Y Z

82,83,84 85,86,87 91,92,93

88,89,90

Code:

4,5,6,25,26,27,52,53,54,34,35,36,55,56,57,19,20,21,88,89,90,0,0,0,

25,26,27,67,68,69,0,0,0,70,71,72,22,23,24,13,14,15,0,0,0,4,5,6,13,14,15,

67,68,69,70,71,72,0,0,0,7,8,9,37,38,39,1,2,3,67,68,69,67,68,69


Decoding translation1

Decoding - Translation

Space A B C D E F G

0,0,0 1,2,3 4,5,6 7,8,9 10,11,12 13,14,15 16,17,18 19,20,21

H I J K L M N O

22,23,24 25,26,27 28,29,30 31,32,33 34,35,36 40,41,42 43,44,45 49,50,51

37,38,39 46,47,48 52,53,54

55,56,57

P Q R S T U V W

58,59,60 61,62,63 64,65,66 67,68,69 70,71,72 73,74,75 76,77,78 79,80,81

X Y Z

82,83,84 85,86,87 91,92,93

88,89,90

Code: 64,65,66,13,14,15,1,2,3,10,11,12,25,26,27,46,47,48,19,20,21,0,0,0 4,5,6,25,26,27,52,53,54,34,35,36,55,56,57,19,20,21,88,89,90,0,0,0, 25,26,27,67,68,69,0,0,0,16,17,18,73,74,75,46,47,48


Decoding translation2

Decoding - Translation

Space A B C D E F G

0,0,0 1,2,3 4,5,6 7,8,9 10,11,12 13,14,15 16,17,18 19,20,21

H I J K L M N O

22,23,24 25,26,27 28,29,30 31,32,33 34,35,36 40,41,42 43,44,45 49,50,51

37,38,39 46,47,48 52,53,54

55,56,57

P Q R S T U V W

58,59,60 61,62,63 64,65,66 67,68,69 70,71,72 73,74,75 76,77,78 79,80,81

X Y Z

82,83,84 85,86,87 91,92,93

88,89,90

Code: 25,26,27,0,0,0,34,35,36,52,53,54,76,77,78,13,14,15,0,0,0 4,5,6,25,26,27,52,53,54,34,35,36,55,56,57,19,20,21,88,89,90,0,0,0,4,5,613,14,15,67,68,69,70,71,72


Making a protein from mrna

Making a Protein from mRNA

  • If each nucleotide = 1 aa – how many aa?

  • If 2 nucleotides = 1 aa – how many?

  • If 3?

  • 3 nucleotides = 1aa

  • Only 20 aa so it’s a degenerate code


Why is proper protein production so important

Codon – triplet of mRNA that codes for an aa

Anti-codon – triplet on tRNA that base pairs with mRNA

tRNA has the anti-

codon on one side and

The amino acid on the

other side so they match

Up.


How does the ribosome know where to begin translation

How does the ribosome know where to begin translation?

  • The cap leads the transcript into the ribosome in the right direction

  • The start codon (AUG) sets the reading frame (the correct sets of 3 nucleotides)

  • The start codon is always the first thing translated – it matches to the amino acid methionine


Translation

Translation

  • Processed mRNA binds to ribosome at the start codon (AUG on mRNA, anti-codon UAC, methionine aa) Sets the reading frame

  • tRNA attaches to start codon

  • Next tRNA binds to 2nd codon


Translation continued

Translation Continued

  • The 2 aa are covalently bonded (peptide bond)

  • The aa lose their attachment to the tRNA in the first site so both are only attached to the tRNA in the second site (so aa is transferred from it’s orginaltRNA to the new one)

  • The tRNA moves forward, dragging the mRNA with it.

  • The first tRNA falls off and goes to get a new aa in the cytoplasm


More translation

More Translation

Translation Animation

  • The tRNA with the aa chain has moved down one codon.

  • A new tRNA and aa enters the open site and a peptide bonds forms between the new aa and the existing chain again transferring the chain of aa to the newest tRNA

  • The mRNA moves forward again and this continues until it reaches a stop codon (UAA, UAG, UGA)

  • The protein enters the RER.


Amino acid chart

Amino Acid Chart

  • Methionine

  • Proline

  • Leucine

  • Isoleucine

  • Proline

  • Lysine

  • stop


Post translational modifications once inside the er

Post-translational ModificationsOnce inside the ER….

  • aa’s can be removed

  • Lipids, carbs, sugars, phosphates may be added

  • The chain may be hooked up with another protein to form subunits of a protein with quarternary structure

  • The chain may be cut into smaller pieces that may hook together

  • Folds into tertiary structure


Mutations

Mutations

Changes in nitrogen bases in DNA

How can mutations come about?

  • Errors in replication not picked up by the proofreading enzyme attached to DNA polymerase (about 3-6/replication)

  • Environmental insults

    • Radiation

      • UV rays from the sun

      • X-rays

      • TV, cell phones, high power lines

      • Radon gas

    • Chemicals – man-made and natural

    • Irritation – abestos, rubbing


Results of mutation to the individual cell

Results of Mutation to the Individual Cell

If a cell acquires a mutation :

  • Repair enzyme fixes it or if occurs during replication – proofreading enzyme fixes it

  • Cell dies

  • Cell makes mutated proteins, doesn’t effect cell or doesn’t read that gene anyway

  • Damage activates cell suicide (apoptosis)

  • Cell becomes cancerous if mutate apoptosis genes, cell cycle control genes, crawling genes, etc.)

  • If cell is a sperm or egg, the child now has that mutated DNA in every cell of the body


Types of mutations

Types of Mutations

  • Point Mutations (1 single base change)

    • Due to Substitutions

    • DNA polymerase adds the wrong base

    • Environmental insult alters a base to look more like a different base – once copied it becomes permanent

  • Frame-shift mutations (shift the reading frame)

    • Deletions – lose a base

    • Insertions – add a base


Effects of mutations on proteins

Effects of Mutations on Proteins

  • Point Mutations (Substitutions)

    No change in protein

    Degenerate code – codes for same aa

    Change in non-coding region

    Changes 1 aa (change shape a lot or a little)

    Shortens protein – changes start codon so begins translation late

    Lengthens protein – changes stop codon so it keeps going through the trailer and poly-A tail


Effects of insertions and deletions

Effects of Insertions and Deletions

  • Frame-shift Mutations (changes the reading frame)

    • All aa are wrong after the insertion or the deletion

  • Only mutations in the sperm or egg can be passed onto to offspring!

  • Remember that mutations can be good, bad, or neutral to the organism!


  • Login