Translation
This presentation is the property of its rightful owner.
Sponsored Links
1 / 13

Translation PowerPoint PPT Presentation


  • 55 Views
  • Uploaded on
  • Presentation posted in: General

Translation. By Josh Morris. mRNA strand. AUGCUGUCAGUAGGACCCUAG. AUG Methionine. CCC Proline. CUG Leucine. UAG Stop (release factor). UCA Serine. GUA Valine. GGA Glycine. Cytoplasm. UAC. GAC.

Download Presentation

Translation

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Translation

Translation

By Josh Morris


Mrna strand

mRNA strand

AUGCUGUCAGUAGGACCCUAG


Translation

AUG

Methionine

CCC

Proline

CUG

Leucine

UAG

Stop (release factor)

UCA

Serine

GUA

Valine

GGA

Glycine


Translation

Cytoplasm

UAC

GAC

AUG CUG UCA GUA GGA CCC UAG


Translation

Cytoplasm

UAC

GAC

AGU

AUG CUG UCA GUA GGA CCC UAG


Translation

Cytoplasm

GAC

AGU

CAU

UAC

AUG CUG UCA GUA GGA CCC UAG


Translation

Cytoplasm

AGU

CAU

CCU

GAC

AUG CUG UCA GUA GGA CCC UAG


Translation

Cytoplasm

CAU

CCU

AAA

AGU

AUG CUG UCA GUA GGA CCC UAG


Translation

Cytoplasm

CAU

AAA

AGU

AUC

AUG CUG UCA GUA GGA CCC UAG


Translation

Cytoplasm

AAA

CCU

AUC

AUG CUG UCA GUA GGA CCC UAG


Translation

Cytoplasm

AAA

AUC

AUG CUG UCA GUA GGA CCC UAG


  • Login