Identifying human disease genes
Download
1 / 58

Identifying human disease genes - PowerPoint PPT Presentation


  • 830 Views
  • Updated On :

Identifying human disease genes . Overview Position independent methods Positional cloning Synteny Drosophila mutants that are positional candidates for human disease genes. Identifying human disease genes. Overview of the process. Identifying human disease genes.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Identifying human disease genes ' - victoria


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Identifying human disease genes l.jpg
Identifying human disease genes

  • Overview

  • Position independent methods

  • Positional cloning

  • Synteny

  • Drosophila mutants that are positional candidates for human disease genes


Identifying human disease genes2 l.jpg
Identifying human disease genes

  • Overview of the process


Identifying human disease genes4 l.jpg
Identifying human disease genes

  • Position independent methods

    • Complementation




Identifying human disease genes7 l.jpg
Identifying human disease genes

  • Position dependent methods

    • CF gene chromosome jumping and walking


Identifying human disease genes9 l.jpg
Identifying human disease genes

  • Mouse and human synteny


Identifying human disease genes11 l.jpg
Identifying human disease genes

  • Drosophila and human disorders


Genetic testing l.jpg
Genetic testing

  • Overview

  • Examples CF gene


Genetic testing15 l.jpg
Genetic testing

  • CF testing

    • ARMs

    • OLA

    • Sequencing

    • Heteroduplex screening

    • DGGE

    • Mismatch cleavage


Genetic testing22 l.jpg
Genetic testing

  • Oligonucleotide arrays





Genetic testing26 l.jpg
Genetic testing

  • Forensics

    • Species identification

    • Paternity testing

    • DNA quantitation

    • Human identification


Slide27 l.jpg

Complex Biomaterials?

Presence of human DNA?

No

Yes

Exclusively human?

If not human, What?

Yes

No

Mixed species?

Single contributor?

No

Yes

DNA quantitation



Slide29 l.jpg

100 bp DNA ladder Negative control Cow Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human

100 bp DNA ladder Negative control Cow Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human

100 bp DNA ladder Negative control Cow Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human

A

E

I

Avian

Equine

Mouse

B

F

J

Waterfowl

Hamster

Canine

C

G

Guinea Pig

Feline

D

H

Rat

Rabbit


Slide31 l.jpg

Our Assay Design Objectives Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human

  • Human Specific

a. Comparison of genomic sequences

b. Testing complex biomaterials

2. Target Specific

a. Comparison of target sequences

b. Testing for non-specific amplification

3. Multiplex Compatible

a. ABI Prism 7000 default PCR conditions

b. Experimentally optimized PCR reagents

FAM

VIC

NED


Nuclear dna l.jpg

Nuclear DNA Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human


Slide33 l.jpg

Schematic of inter-Alu and intra-Alu PCR Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human

Inter-Alu PCR

5’ Alu 3’

3’ Alu 5’

5’ Alu 3’

5’ Alu 3’

tail to tail

head to head

tail to head

Intra-Alu PCR

5’ Alu Element 3’


Slide34 l.jpg

AluY Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human

GGCCGGGCGCGGTGGCTCACGCCTGT

AATCCCAGCACTTTGGGAGGC

CGA

50

AluYb8

...........................

.......................

50

AluY

GGCGGGCGGATCACGAGGT

CAG

GAGATCGAGACCATCCTGGCTAACACGG

100

AluYb8

......T......T

............

.....................A..

100

AluY

TGAAA

CCCCGTCTCTACTAAAAATAC

AAAAAATTAGCCGGGCGTGGTGGC

150

AluYb8

..........................

.................C......

150

AluY

GGGCGCCTGTAGTCCCAGCTACTCGG

GAGGCTGAGGCAGGAGAATGGCGT

200

AluYb8

.........................................

.........

200

AluY

CTTGCAGTGAGCCGAGAT

GAACCCGGGAGGCGGAG

CGCGCC

ACTGCA

C

TC

250

AluYb8

T

..........A...............

.........

...........

G

..

250

AluY

GACAGAGCGAGACTCCGTCTC

C

A

-------

GCCT

GGGC

AAAAAA

287

AluYb8

.

GCAGTCCG

.............................

......294

Nuclear DNA target design

Intra-Alu Yb8

PCR primers

TaqMan-MGB probe


Slide35 l.jpg

Serial dilution of human nuclear DNA Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human

100 ng

10 ng

1 ng

0.1 ng

0.01ng

1 pg


Slide36 l.jpg

14 Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human

16

nDNA

18

y = -1.4761Ln(x) + 21.236

2

R

= 0.9998

20

22

Threshold PCR cycle

24

26

28

30

32

34

100

10

1

0.1

0.01

0.001

DNA (ng)

Nuclear DNA linear quantitation range

VIC


Mitochondrial dna l.jpg

Mitochondrial DNA Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human


Slide38 l.jpg

Mitochondrial DNA assay Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human

PCR primers

TaqMan-MGB probe

Incorporates specific diagnostic bases at the 3’ ends of each primer


Slide39 l.jpg

14 Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human

16

18

20

22

Threshold PCR cycle

24

mtDNA

26

y = -1.4769Ln(x) + 22.547

2

R

= 0.9999

28

30

32

34

100

10

1

0.1

0.01

0.001

DNA (ng)

Mitochondrial DNAlinear quantitation range

FAM


Y chromosome dna l.jpg

Y chromosome DNA Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human


Slide41 l.jpg

Human Y-chromosome DNA assay design Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human

Human X-chromosome 90 bp deletion in the X-Y homologous region

PCR primers

TaqMan-MGB probe


Slide42 l.jpg

Population Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human

Males

Females

Total

291

African-American

150

141

109

European-American

49

60

16

Hispanic-American

9

7

129

North-American

75

54

19

South-American

7

12

29

Asian

15

14

Total

305

288

593

Human Y chromosome locus fixation


Slide43 l.jpg

27 Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human

29

31

Threshold PCR cycle

33

Male Y

y = -1.4935Ln(x) + 34.74

35

2

R

= 0.9994

37

39

100

10

1

0.1

DNA (ng)

Male Y DNA linear quantitation range

NED


Multiplex analysis l.jpg

Multiplex Analysis Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human


Slide45 l.jpg

Multiplex Analysis Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human

  • Amplicon compatibility

a. Test assays and modify amplicons

2. Human specificity

a. Analyze mixed DNA samples

3. Background amplification

a. Analyze DNA from nearest neighbors


Slide46 l.jpg

Contents Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human

Human male

Dog

Cat

Total template

Mix

DNA (ng)

%

DNA (ng)

%

DNA (ng)

%

DNA (ng)

%

1

50

50

25

25

25

25

100

100

2

5

50

2.5

25

2.5

25

10

100

3

0.5

5

5

50

4.5

45

10

100

4

0.05

0.5

5

50

4.95

49.5

10

100

5

0.005

0.05

5

50

4.995

49.95

10

100

“DNA mixtures” to test human specificity


Slide47 l.jpg

14 Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human

16

nDNA

18

y = -1.4761Ln(x) + 21.236

2

R

= 0.9998

20

22

24

Threshold PCR cycle

mtDNA

26

y = -1.4769Ln(x) + 22.547

2

R

= 0.9999

28

30

32

34

100

10

1

0.1

0.01

0.001

DNA (ng)

Linear quantitative range of nDNA / mtDNA duplex

The open symbols along each standard curve represent detection of human DNA within a mixed sample.

nDNA

VIC

mtDNA

FAM


Slide48 l.jpg

18 Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human

20

nDNA

22

mtDNA

24

Threshold PCR cycle

26

28

30

32

34

rat

cat

pig

dog

cow

deer

NTC

rabbit

horse

mouse

sheep

Gorilla

chicken

Bonobo

Human nuclear

Common chimp

Human genomic

DNA Source

Duplex background amplification


Slide49 l.jpg

18 Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human

20

nDNA

y = -2.1185Ln(x) + 29.336

22

2

R

= 1

24

mtDNA

26

y = -1.8375Ln(x) + 30.479

2

28

R

= 0.9974

Threshold PCR cycle

30

32

34

36

Male Y

y = -1.3824Ln(x) + 35.492

38

2

R

= 0.9958

40

100

10

1

0.1

0.01

DNA (ng)

Linear quantitative range of a nDNA / mtDNA / maletriplex PCR assay

The open symbols along each standard curve represent accurate detection of human DNA within a mixed sample.

VIC

FAM

NED


Slide50 l.jpg

24 Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human

26

28

nDNA

mtDNA

30

Male Y

Threshold PCR cycle

32

34

36

38

40

cat

pig

rat

dog

cow

deer

NTC

rabbit

horse

Gorilla

sheep

mouse

chicken

Human Male

Bonobo

Human Female

Common chimp

DNA source

Triplex background amplification


Slide51 l.jpg

Linear quantitative ranges Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human

DNA template

100 ng 10 ng 1 ng 100 pg 10 pg 1 pg

nDNA

Each assay individually

mtDNA

Male Y

Duplex

Triplex


Slide52 l.jpg

Duplex PCR for Human Sex Typing Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human

X PCR primers

Y PCR primers

TaqMan-MGB probes


Slide53 l.jpg

Duplex PCR for Human Sex Typing Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human



Slide55 l.jpg

Human Population Biology and Investigative Forensics ancestral lineages.

1. Since the dispersal from Africa, mobile elements have continued to expand in the human genome.2. Many elements are polymorphic and occur at high/low frequencies in human populations.3. These elements can be exploited to examine human population history.4. Display-based PCR methods can be used to “extract” recent, population-indicative elements.


Inferring geographic affiliation l.jpg

Forensic Sci. Intl. (In press) ancestral lineages.

Forensic Sci. Intl. (In press)

Inferring Geographic Affiliation

  • Series of genetic markers (100 Alu loci)

  • Database of human variation

    (currently 715 individuals of known ancestry)

  • Genotype unknown sample

  • Analytical approach (Structure analysis)


Slide57 l.jpg

Identifying 18 Unknown DNAs ancestral lineages.

Forensic Sci. Intl. (In press)


ad