Banques de donnes:
1 / 52

Banques de données: Indicateurs d’évolution et de spéciation Alignement des séquences - PowerPoint PPT Presentation

  • Uploaded on
  • Presentation posted in: General

Banques de données: Indicateurs d’évolution et de spéciation Alignement des séquences. Alignements vers 1960. b -corticotropine (ovine) Corticotropine A (porcine). ala gly glu asp asp glu asp gly ala glu asp glu. CYIQNCPLG CYFQNCPRG. Oxytocine Vasopressine.

I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.

Download Presentationdownload

Banques de données: Indicateurs d’évolution et de spéciation Alignement des séquences

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript

Banques de donn es indicateurs d volution et de sp ciation alignement des s quences

Banques de donnes:

Indicateurs dvolution

et de spciation

Alignement des


Banques de donn es indicateurs d volution et de sp ciation alignement des s quences

Alignements vers 1960

b-corticotropine (ovine)

Corticotropine A (porcine)

ala gly glu asp asp glu

asp gly ala glu asp glu





Alignement de s quences op ration la plus fondamentale

Alignement de squencesOpration la plus fondamentale

  • Savoir si 2 protines ou 2 gnes sont relis structuralement ou fonctionnellement.

  • Identifier des domaines ou des motifs rcurrents.

  • la base des recherches en blast.

  • Analyse du gnome.

Alignement de prot ines vs adn

Alignement de protines vs ADN

Une protine contient plus dinformation (20 vs 4). De plus plusieurs aa sont quivalents.

Les codons sont dgnrs (souvent, chgmt position 3 code le mme aa).

Les squences aa procurent une vision + longue.

Squences ADN peuvent tre traduites avant un alignement.

S quence prot ine informative que s quence de dna

Squence protine + informative que squence de DNA

le DNA peut tre traduit selon 6 cadres de lecture









Mais aligner des s q adn peut permettre de

mais aligner des sq. ADN peut permettre de

  • Confirmer identit dun cDNA

  • tudier les squences non codantes

  • tudier le polymorphisme

  • Vous comparer lh. de cromagnon

Query: 181 catcaactacaactccaaagacacccttacacccactaggatatcaacaaacctacccac 240

Sbjct: 189 catcaactgcaaccccaaagccacccct-cacccactaggatatcaacaaacctacccac 247

Il y a des pi ges

Il y a des piges

retinol-binding protein




2 lipocalines issues de la duplication dun gne. Structures 3D trs semblables

mais peu didentits daa dans la squence.

Alignement s q pairwise

Alignement sq. (pairwise)

talement de 2 ou plusieurs squences afin dachever le maximum didentit (et de conservation dans le cas des aa) en vue dtablir leur degr de similarit et leur homologie.

D finitions


  • Homologie : Similarit attribue la descendance dun anctre commun

  • Identit: Degr dinvariance dune squence de nuclotides ou aa


+ K ++ + + + GTW++ MA + L + A V T + +L+ W+


2 types d homologie

2 types dhomologie

  • Orthologues: squences homologues dans des espces diffrentes issues dun gne ancestral commun au cours de la spciation. Peuvent avoir la mme fonction.

  • Paralogues: squences homologues chez une mme espce, issues de la duplication dun gne.

Banques de donn es indicateurs d volution et de sp ciation alignement des s quences

common carp


rainbow trout


Orthologues de la RBP

(rt. binding prot.)









10 chgmts




Banques de donn es indicateurs d volution et de sp ciation alignement des s quences

apolipoprotein D


protein 4


Membres de la mme famille de protines chez Hs.


component 8





D2 synthase










protein 2A

10 chgmts

Lipocalin 1

Alignement global

Alignement global


. ||| | . |. . . | : .||||.:| :



: | | | | :: | .| . || |: || |.



|| ||. | :.|||| | . .|



. | | | : || . | || |


D finitions1


  • Similarit: degr de relation de 2 squences (identit + conservation)

  • Identit: degr dinvariance

  • Conservation: changement qui conserve la proprit physicochimique (aa seulement)

Banques de donn es indicateurs d volution et de sp ciation alignement des s quences

RBP vs Lactoglob.


. ||| | . |. . . | : .||||.:| :



: | | | | :: | .| . || |: || |.



|| ||. | :.|||| | . .|



. | | | : || . | || |


Simil. +/-




Interne ou terminal

Banques de donn es indicateurs d volution et de sp ciation alignement des s quences


  • Position o une lettre nest apparie rien

  • On lui donne gnralement un score ngatif

  • Comme une mutation peut donner une insertion ou une dltion de plus dun rsidu, la prsence dun gap est plus importante que sa longueur

Gaps r v lateurs

Gaps rvlateurs


. ||| | . |. . . | : .||||.:| :



: | | | | :: | .| . || |: || |.



|| ||. | :.|||| | . .|



. | | | : || . | || |


Banques de donn es indicateurs d volution et de sp ciation alignement des s quences

RBP vs RBP (Hs vs O. mykiss truite arc-en-ciel)


:: || || || .||.||. .| :|||:.|:.| |||.|||||


. . . . .


|||| ||:||:|||||.|.|.||| ||| :||||:.||.| ||| || |


. . . . .


||||||:||| ||:|| ||||||::||||| ||: |||| ..||||| |


. . . . .


|||:||| | || || |||| :..|:| .|| : | |:|:


Alignement volution

Alignement volution


De la vie



Origine des







Milliards dannes





Banques de donn es indicateurs d volution et de sp ciation alignement des s quences

glyceraldehyde 3-phosphate dshydrogenases



















Banques de donn es indicateurs d volution et de sp ciation alignement des s quences

Famille des lipocalines

Squences paralogues chez Hs










motif GXW

Approche g n rale

Approche gnrale

  • Choisir les squences

  • Slectionner un algorithme

  • Permettre ou pas les gaps

  • Choisir un alignement global ou local

  • Estimer la probabilit que alignement survienne par hasard.

Calcul d un score d alignement

Calcul dun score dalignement

L analyse de margaret dayhoff sur 34 familles de prot ines

Lanalyse de Margaret Dayhoff sur 34 familles de protines

ProtineMutations / 100 millions annes

Ig kappa chain37

Kappa casein33


Hemoglobin a12



Histone H40.10


Fr quence des remplacements 1572 cas les valeurs sont x10

Frquence des remplacements1572 cas (les valeurs sont x10)

Banques de donn es indicateurs d volution et de sp ciation alignement des s quences

Occurrence des aa











bleu=6 codons; rouge=1 codon

Banques de donn es indicateurs d volution et de sp ciation alignement des s quences

Mutabilit relative des aa

# mut / frq. occurr.











Banques de donn es indicateurs d volution et de sp ciation alignement des s quences

Acide amin original

Acide amin de remplacement

Probabilit de mutation si on accepte 1% de changement

Point accepted mutation = 1% PAM1

Banques de donn es indicateurs d volution et de sp ciation alignement des s quences

Les valeurs dans cette matrice rfltent la probabilit de substitution de laa original (range du haut) par un autre (colonne de gauche.

Matrice de substitution pam blossum

Matrice de substitution (PAM & BLOSSUM)

  • Contient des valeurs proportionnelles la probabilit quun aa i subisse une mutation en aa j (pour chaque paire aa aligns)

  • Les matrices sont construites empiriquement partir de squences connues

  • Elles devraient rflter la vritable probabilit de mutation sur une priode de temps donne

Matrices pam

Matrices PAM

  • Bases sur lalignement global de protines trs relies (>85% identit aa)

  • PAM 1 est obtenue par comparaison de squences qui divergent de 1% ou moins

  • Les autres matrices PAM sont extrapoles partir de PAM 1

Banques de donn es indicateurs d volution et de sp ciation alignement des s quences

















































































PAM 2000










Comment extrapoler partir de pam1

Comment extrapoler partir de PAM1 ?

probabilit x probabilit

Banques de donn es indicateurs d volution et de sp ciation alignement des s quences


Somme des colonnes = 100 ou 101

Matrice de probabilit de mutation matrice de pointage

Matrice de probabilit de mutation Matrice de pointage

  • Donner un pointage (score) un alignement: ratio de vraisemblance


Pourquoi le log ? Plus facile dadditionner que de multiplier.

Banques de donn es indicateurs d volution et de sp ciation alignement des s quences


Matrice de vraisemblance (log odds)

Pourquoi tablir une matrice logarithmique de vraisemblance

Pourquoi tablir une matrice logarithmique de vraisemblance

Sous forme dun log, il ne reste qu additionner les scores pour chaque paire daa au lieu de les multiplier

Expl pour 2 tryptophanes align s s w w 10 log 0 55 0 010 17 4

Expl. pour 2 tryptophanes aligns S(W/W)=10 log(0,55/0,010) = 17,4

Un score de +17 pour lalignement de 2 W signifie que cet alignement est 50 fois plus vraisemblable quun alignement simplement du au hasard.

Signification de ces chiffres

Signification de ces chiffres

  • Score =+2 indique que ce remplacement survient 1.6 fois plus souvent que le voudrait le hasard

  • Score =0 ne dit rien (neutre)

  • Score =-10 indique que la possibilit que lalignement de ces 2 aa reprsente correctement une homologie est 10 fois moins probable quun alignement par chance des ces 2 aa.

Banques de donn es indicateurs d volution et de sp ciation alignement des s quences

PAM 250

Banques de donn es indicateurs d volution et de sp ciation alignement des s quences


Banques de donn es indicateurs d volution et de sp ciation alignement des s quences

60% identit score=23

hsrbp, 136 CRLLNLDGTC

btlact, 3 CLLLALALTC

* ** * **



24.7% identity in 81 residues overlap; Score: 77.0; Gap frequency: 3.7%



* **** * * * * ** *



** * ** **


Quelle matrice choisir

Quelle matrice choisir ?

Rat vs souris

Rat vs bactrie


Banques de donn es indicateurs d volution et de sp ciation alignement des s quences

BLOSUM Matrices

Bases sur des alignements locaux

BLOSUM : blocks substitution matrix.

Expl: BLOSUM62 est obtenu en groupant

les squences qui ont 62% identit ou plus.

Banques de donn es indicateurs d volution et de sp ciation alignement des s quences

BLOSUM Matrices










Percent amino acid identity







Banques de donn es indicateurs d volution et de sp ciation alignement des s quences

BLOSUM Matrices

Toutes les matrices BLOSSUM sont bases sur des

alignements observs;

Aucune nest extrapole

La banque BLOCKS database contient des milliers


BLOSUM62 est souvent la matrice de dfaut dans BLAST

Banques de donn es indicateurs d volution et de sp ciation alignement des s quences


Les scores sont plus faibles 2 x logbase2(ratio vraisemblance)

Limites de fiabilit

Limites de fiabilit

Pourcent identit

Differences par 100 residus (PAM)

15% identit, un ne reconnat plus dhomologie

Banques de donn es indicateurs d volution et de sp ciation alignement des s quences

PAM1, 2 protines sont identiques 99%

PAM10.7 : 10 differences par 100 residus

PAM80 : 50 diffrences

PAM250 : 80 differences

  • 2 protines avec 50% didentit peuvent avoir subi

  • 80 changements par 100 rsidus.

  • Nimporte quelle

  • Mutation peut tre rversible

  • Login