Banques de donnes:
Sponsored Links
This presentation is the property of its rightful owner.
1 / 52

Banques de données: Indicateurs d’évolution et de spéciation Alignement des séquences PowerPoint PPT Presentation

  • Uploaded on
  • Presentation posted in: General

Banques de données: Indicateurs d’évolution et de spéciation Alignement des séquences. Alignements vers 1960. b -corticotropine (ovine) Corticotropine A (porcine). ala gly glu asp asp glu asp gly ala glu asp glu. CYIQNCPLG CYFQNCPRG. Oxytocine Vasopressine.

Download Presentation

Banques de données: Indicateurs d’évolution et de spéciation Alignement des séquences

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript

Banques de donnes:

Indicateurs dvolution

et de spciation

Alignement des


Alignements vers 1960

b-corticotropine (ovine)

Corticotropine A (porcine)

ala gly glu asp asp glu

asp gly ala glu asp glu





Alignement de squencesOpration la plus fondamentale

  • Savoir si 2 protines ou 2 gnes sont relis structuralement ou fonctionnellement.

  • Identifier des domaines ou des motifs rcurrents.

  • la base des recherches en blast.

  • Analyse du gnome.

Alignement de protines vs ADN

Une protine contient plus dinformation (20 vs 4). De plus plusieurs aa sont quivalents.

Les codons sont dgnrs (souvent, chgmt position 3 code le mme aa).

Les squences aa procurent une vision + longue.

Squences ADN peuvent tre traduites avant un alignement.

Squence protine + informative que squence de DNA

le DNA peut tre traduit selon 6 cadres de lecture









mais aligner des sq. ADN peut permettre de

  • Confirmer identit dun cDNA

  • tudier les squences non codantes

  • tudier le polymorphisme

  • Vous comparer lh. de cromagnon

Query: 181 catcaactacaactccaaagacacccttacacccactaggatatcaacaaacctacccac 240

Sbjct: 189 catcaactgcaaccccaaagccacccct-cacccactaggatatcaacaaacctacccac 247

Il y a des piges

retinol-binding protein




2 lipocalines issues de la duplication dun gne. Structures 3D trs semblables

mais peu didentits daa dans la squence.

Alignement sq. (pairwise)

talement de 2 ou plusieurs squences afin dachever le maximum didentit (et de conservation dans le cas des aa) en vue dtablir leur degr de similarit et leur homologie.


  • Homologie : Similarit attribue la descendance dun anctre commun

  • Identit: Degr dinvariance dune squence de nuclotides ou aa


+ K ++ + + + GTW++ MA + L + A V T + +L+ W+


2 types dhomologie

  • Orthologues: squences homologues dans des espces diffrentes issues dun gne ancestral commun au cours de la spciation. Peuvent avoir la mme fonction.

  • Paralogues: squences homologues chez une mme espce, issues de la duplication dun gne.

common carp


rainbow trout


Orthologues de la RBP

(rt. binding prot.)









10 chgmts




apolipoprotein D


protein 4


Membres de la mme famille de protines chez Hs.


component 8





D2 synthase










protein 2A

10 chgmts

Lipocalin 1

Alignement global


. ||| | . |. . . | : .||||.:| :



: | | | | :: | .| . || |: || |.



|| ||. | :.|||| | . .|



. | | | : || . | || |



  • Similarit: degr de relation de 2 squences (identit + conservation)

  • Identit: degr dinvariance

  • Conservation: changement qui conserve la proprit physicochimique (aa seulement)

RBP vs Lactoglob.


. ||| | . |. . . | : .||||.:| :



: | | | | :: | .| . || |: || |.



|| ||. | :.|||| | . .|



. | | | : || . | || |


Simil. +/-




Interne ou terminal


  • Position o une lettre nest apparie rien

  • On lui donne gnralement un score ngatif

  • Comme une mutation peut donner une insertion ou une dltion de plus dun rsidu, la prsence dun gap est plus importante que sa longueur

Gaps rvlateurs


. ||| | . |. . . | : .||||.:| :



: | | | | :: | .| . || |: || |.



|| ||. | :.|||| | . .|



. | | | : || . | || |


RBP vs RBP (Hs vs O. mykiss truite arc-en-ciel)


:: || || || .||.||. .| :|||:.|:.| |||.|||||


. . . . .


|||| ||:||:|||||.|.|.||| ||| :||||:.||.| ||| || |


. . . . .


||||||:||| ||:|| ||||||::||||| ||: |||| ..||||| |


. . . . .


|||:||| | || || |||| :..|:| .|| : | |:|:


Alignement volution


De la vie



Origine des







Milliards dannes





glyceraldehyde 3-phosphate dshydrogenases



















Famille des lipocalines

Squences paralogues chez Hs










motif GXW

Approche gnrale

  • Choisir les squences

  • Slectionner un algorithme

  • Permettre ou pas les gaps

  • Choisir un alignement global ou local

  • Estimer la probabilit que alignement survienne par hasard.

Calcul dun score dalignement

Lanalyse de Margaret Dayhoff sur 34 familles de protines

ProtineMutations / 100 millions annes

Ig kappa chain37

Kappa casein33


Hemoglobin a12



Histone H40.10


Frquence des remplacements1572 cas (les valeurs sont x10)

Occurrence des aa











bleu=6 codons; rouge=1 codon

Mutabilit relative des aa

# mut / frq. occurr.











Acide amin original

Acide amin de remplacement

Probabilit de mutation si on accepte 1% de changement

Point accepted mutation = 1% PAM1

Les valeurs dans cette matrice rfltent la probabilit de substitution de laa original (range du haut) par un autre (colonne de gauche.

Matrice de substitution (PAM & BLOSSUM)

  • Contient des valeurs proportionnelles la probabilit quun aa i subisse une mutation en aa j (pour chaque paire aa aligns)

  • Les matrices sont construites empiriquement partir de squences connues

  • Elles devraient rflter la vritable probabilit de mutation sur une priode de temps donne

Matrices PAM

  • Bases sur lalignement global de protines trs relies (>85% identit aa)

  • PAM 1 est obtenue par comparaison de squences qui divergent de 1% ou moins

  • Les autres matrices PAM sont extrapoles partir de PAM 1

















































































PAM 2000










Comment extrapoler partir de PAM1 ?

probabilit x probabilit


Somme des colonnes = 100 ou 101

Matrice de probabilit de mutation Matrice de pointage

  • Donner un pointage (score) un alignement: ratio de vraisemblance


Pourquoi le log ? Plus facile dadditionner que de multiplier.


Matrice de vraisemblance (log odds)

Pourquoi tablir une matrice logarithmique de vraisemblance

Sous forme dun log, il ne reste qu additionner les scores pour chaque paire daa au lieu de les multiplier

Expl. pour 2 tryptophanes aligns S(W/W)=10 log(0,55/0,010) = 17,4

Un score de +17 pour lalignement de 2 W signifie que cet alignement est 50 fois plus vraisemblable quun alignement simplement du au hasard.

Signification de ces chiffres

  • Score =+2 indique que ce remplacement survient 1.6 fois plus souvent que le voudrait le hasard

  • Score =0 ne dit rien (neutre)

  • Score =-10 indique que la possibilit que lalignement de ces 2 aa reprsente correctement une homologie est 10 fois moins probable quun alignement par chance des ces 2 aa.

PAM 250


60% identit score=23

hsrbp, 136 CRLLNLDGTC

btlact, 3 CLLLALALTC

* ** * **



24.7% identity in 81 residues overlap; Score: 77.0; Gap frequency: 3.7%



* **** * * * * ** *



** * ** **


Quelle matrice choisir ?

Rat vs souris

Rat vs bactrie


BLOSUM Matrices

Bases sur des alignements locaux

BLOSUM : blocks substitution matrix.

Expl: BLOSUM62 est obtenu en groupant

les squences qui ont 62% identit ou plus.

BLOSUM Matrices










Percent amino acid identity







BLOSUM Matrices

Toutes les matrices BLOSSUM sont bases sur des

alignements observs;

Aucune nest extrapole

La banque BLOCKS database contient des milliers


BLOSUM62 est souvent la matrice de dfaut dans BLAST


Les scores sont plus faibles 2 x logbase2(ratio vraisemblance)

Limites de fiabilit

Pourcent identit

Differences par 100 residus (PAM)

15% identit, un ne reconnat plus dhomologie

PAM1, 2 protines sont identiques 99%

PAM10.7 : 10 differences par 100 residus

PAM80 : 50 diffrences

PAM250 : 80 differences

  • 2 protines avec 50% didentit peuvent avoir subi

  • 80 changements par 100 rsidus.

  • Nimporte quelle

  • Mutation peut tre rversible

  • Login