high throughput genotyping
Download
Skip this Video
Download Presentation
High-throughput genotyping

Loading in 2 Seconds...

play fullscreen
1 / 26

High-throughput genotyping - PowerPoint PPT Presentation


  • 295 Views
  • Uploaded on

High-throughput genotyping. What is genotyping?. the analysis of DNA-sequence variation genotype = the genetic constitution of an individual. Alleles. alternative form of a gene or DNA sequence at a specific chromosomal location (locus)

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'High-throughput genotyping' - verna


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
what is genotyping
What is genotyping?
  • the analysis of DNA-sequence variation
  • genotype = the genetic constitution of an individual

Finnish Genome Center

alleles
Alleles
  • alternative form of a gene or DNA sequence at a specific chromosomal location (locus)
  • at each locus an individual possesses two alleles, one inherited from the father one from the mother

→ genotype: a sum of these two alleles

Finnish Genome Center

slide4

Genetic differences:

  • may cause or predispose to diseases
  • determines e.g. individual drug response
  • used as markers to identify predisposing genes for diseases

→ high-throughput genotyping technologies needed

Finnish Genome Center

microsatellite markers
Microsatellite markers

Di-, tri-, tetranucleotide repeats

GAACGTACTCACACACACACACATTTGAC

TTCGATGATAGATAGATAGATAGATACGT

Finnish Genome Center

microsatellite markers6
...Microsatellite markers
  • also called:
    • STR= Single Tandem Repeat
    • SSR= Simple Sequence Repeat
    • SSLP= Simple Sequence Length Polymorphism
  • the number of repeats varies (→ 30)
  • highly polymorphic
  • distributed evenly throughout the genome
  • easy to detect by PCR

Finnish Genome Center

snp markers
SNP markers
  • single nucleotide variation

GTGGACGTGCTT[G/C]TCGATTTACCTAG

Finnish Genome Center

snp markers8
...SNP markers
  • The most simple and common type of polymorphism
  • Highly abundant; every 1000 bp along human genome
  • Most SNPs do not affect on cell function
    • some SNPs could predispose people to disease
    • influence the individual’s response to a drug
  • Widely used as genetic markers

Finnish Genome Center

snp genotyping methods
SNP genotyping methods
  • over 100 different approaches
  • Ideal SNP genotyping platform:
    • high-throughput capacity
    • simple assay design
    • robust
    • affordable price
    • automated genotype calling
    • accurate and reliable results

Finnish Genome Center

snp genotyping methods10
...SNP genotyping methods
  • PCR
  • discrimination between alleles:
    • allele-specific hybridization
    • allele-specific primer extension
    • allele-specific oligonucleotide ligation
    • allele-specific enzymatic cleavage
  • detection of the allelic discrimination:
    • light emitted by the products
    • mass
    • change in the electrical property

Finnish Genome Center

slide11

The Finnish Genome Center

  • Independent department of University of Helsinki
  • Since 1998
  • National core facility for the genetic research of multifactorial diseases
  • Provides collaboration and genotyping service to scientist and research groups in Finland, also abroad

Finnish Genome Center

slide12

The Finnish Genome Center; Goals

  • help designing genetic studies
  • perform high-throughput genotyping
  • perform data analysis
  • training of scientists
  • adopt and develop new strategies & technologies

Finnish Genome Center

research strategies
Research strategies
  • Genome wide scans with microsatellite markers
    • ~400 dinucleotidemarkers, ~10 cM spacing
  • Fine mapping
    • Project specific (microsatellite) markers
  • SNP genotyping
    • Primer extension –methods (SNuPe and MassArray; MALDI-TOF), restriction enzyme –methods, project specific markers

Finnish Genome Center

genome scan
Genome Scan
  • genotyping the whole genome with 400 microsatellite markers at 10 cM interval
  • look for chromosomal regions with excess allele sharing

0

10

20

30

40

50

60

70

80

90

100

110

120

130

microsatellite markers at 10 cM distance

Finnish Genome Center

fine mapping
Fine mapping
  • candidate regions identified by a genome scan
  • candidate genes
  • microsatellite or SNP markers
  • verification of linkage results

Finnish Genome Center

slide16

Setting up PCR-reactions

Finnish Genome Center

slide17

Electrophoresis run

Finnish Genome Center

slide18

Genotypes

Finnish Genome Center

what the data looks like
What the data looks like

Marker Well ID SampleID Allele1 Allele2 Size1 Size2

D7S513 H01 OA.11616 26 28 190.93 195.02

D7S517 C07 DYS.5020 26 26 262.19 262.19

D7S640 B02 DYS.3819 26 29 133.41 139.41

D7S640 G12 OA.1528 26 29 133.59 139.46

D7S669 E05 OA.11615 26 29 190.37 196.61

D8S258 B06 DYS.5001 26 27 159.38 161.38

D8S260 C02 DYS.3931 26 26 215.57 215.57

D8S264 H01 OA.11616 26 26 158.86 158.86

Finnish Genome Center

snp genotyping at fgc
SNP genotyping at FGC
  • PCR-RFLP (restriction fragment length polymorphism)
  • SNuPe (Single nucleotide primer extension)
  • MassARRAY; MALDI-TOF (Matrix Assisted Laser Desorption/Ionization Time-of-flight mass spectrometry)

Finnish Genome Center

pcr rflp
PCR-RFLP
  • Reactions designed to produce products of different sizes after enzymatic cleavage

size in bp

Undigested PCR product

243

C analyte

228

Tanalyte

94

Finnish Genome Center

snupe
SNuPe
  • primer extension reactions designed to produce differentially labelled products
  • analysis by capillary electrophoresis (MegaBACE)

labelled nucleotide

Extendable primer

GGACCTGGAGCCCCCACC

-

C analyte

GGACCTGGAGCCCCCACCC

C (blue)

Tanalyte

GGACCTGGAGCCCCCACCT

T (red)

Finnish Genome Center

massarray system maldi tof
MassARRAY System (MALDI-TOF)
  • Primer extension reactions designed to generate different sized products
  • Analysis by mass spectrometry

C/T

G/A

dTTP

dGTP

ddCTP

dATP

G/A

Mass in Daltons

Extendable primer

GGACCTGGAGCCCCCACC

5430.5

C analyte

GGACCTGGAGCCCCCACCC

5703.7

Tanalyte

GGACCTGGAGCCCCCACCTC

5976,9.9

Finnish Genome Center

mass spectrometry multiplexing
Mass spectrometry multiplexing

Finnish Genome Center

primer extension mass spectrometry
Primer extension mass spectrometry

Advantages:

  • accurate
  • automated assay design
  • fast automated data collection
  • multiplexing capacity

Disadvantages:

  • expensive instruments, consumables
  • extensive post-PCR processing

Finnish Genome Center

snp genotyping workflow at fgc
SNP genotyping workflow at FGC

Finnish Genome Center

ad