Expt. 10-1
This presentation is the property of its rightful owner.
Sponsored Links
1 / 29

Expt. 10-1 : P-elements and Enhancer Trapping PowerPoint PPT Presentation


  • 96 Views
  • Uploaded on
  • Presentation posted in: General

Expt. 10-1 : P-elements and Enhancer Trapping. Expt. 10: P-elements and Enhancer Trapping. Naturally occurring P-elements: Transposase gene between two inverted repeats. Transposase. 31 bp Inverted Repeat. Tnp Binding Site. 9 or 21 bp Spacer. Organization of the P Element.

Download Presentation

Expt. 10-1 : P-elements and Enhancer Trapping

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Expt 10 1 p elements and enhancer trapping

Expt. 10-1: P-elements and

Enhancer Trapping


Expt 10 1 p elements and enhancer trapping

Expt. 10: P-elements and

Enhancer Trapping

  • Naturally occurring P-elements: Transposase gene between two inverted repeats

Transposase


Organization of the p element

31 bp Inverted

Repeat

Tnp Binding

Site

9 or 21 bp Spacer

Organization of the P Element

Transposase ORF

2.9 kb P Element


Expt 10 1 p elements and enhancer trapping

NNNNNNNNNCATGATGAAATAACATA

NNNNNNNNN

3’-OH

5’-P

AGGTGG

GTACTACTTTATTGTATTCCACC

P -5’

HO-3’

Transposase catalyzes a 17bp staggered cleavage event

5’ Cleavage Site

NNNNNNNNNCATGATGAAATAACATAAGGTGG

NNNNNNNNNGTACTACTTTATTGTATTCCACC

3’ Cleavage Site


Expt 10 1 p elements and enhancer trapping

+

P Element


Expt 10 1 p elements and enhancer trapping

8 bp target site

duplication

P Element

P element integration generates an 8 bp target site duplication


Expt 10 1 p elements and enhancer trapping

Taking Advantage of P-elements

-Mutagenesis


Expt 10 1 p elements and enhancer trapping

Taking Advantage of P-elements

-Mutagenesis-Insertional mutations easy to clone.


Expt 10 1 p elements and enhancer trapping

Taking Advantage of P-elements

  • -MutagenesisInsertional mutations (easy to clone).

    • Imprecise excisions lead to frameshifts

    • and deletions.


Expt 10 1 p elements and enhancer trapping

Taking Advantage of P-elements

  • Germline transformation


Expt 10 1 p elements and enhancer trapping

Taking Advantage of P-elements

  • -Mutagenesis

  • Germline transformation

    • 1.Design transgene with inverted repeats.


Expt 10 1 p elements and enhancer trapping

Taking Advantage of P-elements

  • -Mutagenesis

  • Germline transformation

    • 1.Design transgene with inverted repeats.

    • 2.Mix with transposase gene


Expt 10 1 p elements and enhancer trapping

Taking Advantage of P-elements

  • -Mutagenesis

  • Germline transformation

    • 1.Design transgene with inverted repeats.

    • 2.Mix with transposase gene

    • 3.Inject into germline of embryo


Expt 10 1 p elements and enhancer trapping

Taking Advantage of P-elements

  • Germline transformation

    • 1.Design transgene with inverted repeats.

    • 2.Mix with source of transposase

    • 3.Inject into germline of embryo

    • 4.Look for transformants in F1.

YFG


Expt 10 1 p elements and enhancer trapping

Taking Advantage of P-elements

  • -Mutagenesis

  • Germline transformation

  • Enhancer trappingUse regulatory informationfrom nearby genes to drive expression of a transgene


Expt 10 1 p elements and enhancer trapping

Mechanics of Enhancer Trapping:

  • Modified P-element contains:

    • Inverted repeats

    • Basic promoter sequences

    • Molecular marker gene (e.g. b-galactosidase)

    • Phenotypic marker (e.g. w+, ry+)

  • Mobilize using transposase

  • Confirm hopping in F1 (phenotype)

  • Look for interesting/desired expression pattern in F2 with lacZ staining


Expt 10 1 p elements and enhancer trapping

Mechanics of Enhancer Trapping:

  • Modified P-element contains:

    • Inverted repeats

    • Basic promoter sequences

    • Molecular marker gene (e.g. b-galactosidase)

    • Phenotypic marker (e.g. w+, ry+)

  • Mobilize using transposase

  • Confirm hopping in F1 (phenotype)

  • Look for interesting/desired expression pattern in F2 with lacZ staining


Expt 10 1 p elements and enhancer trapping

Attached X females

^

XY X XXY


Expt 10 1 p elements and enhancer trapping

Attached X females

^

XY X XXY

^

XXX Sterile

^

XXYFemale

XYMale

YYDead


Expt 10 1 p elements and enhancer trapping

+ P[lacZ, ry+], Cy ry+ + Ki D2-3, ry+

+Sco ryY + +

X


Expt 10 1 p elements and enhancer trapping

+ P[lacZ, ry+], Cy ry+ + Ki D2-3, ry+

+ Sco ryY + +

X

+ P[lacZ, ry+], CyKi D2-3, ry+XX + ry

Y+ ryY + ry

(phenotype=Cy, Ki, ry+)


Expt 10 1 p elements and enhancer trapping

+ P[lacZ, ry+], Cy ry+ + Ki D2-3, ry+

+ Sco ryY + +

X

+ P[lacZ, ry+], CyKi D2-3, ry+XX + ry

Y +ryY + ry

(phenotype Cy, Ki, ry+)

^

X

^


Expt 10 1 p elements and enhancer trapping

+ P[lacZ, ry+], Cy ry+ + Ki D2-3, ry+

+ Sco ryY + +

X

+ P[lacZ, ry+], CyKi D2-3, ry+XX + ry

Y +ry Y + ry

(Cy, Ki, ry+)

^

X

+P?+P?ryP?XX + ry

Y + ry Y + ry

(not Cy, not Ki. If carrying

a jumped P, will be ry+)

^


Expt 10 1 p elements and enhancer trapping

+ P[lacZ, ry+], Cy ry+ + Ki D2-3, ry+

+ Sco ryY + +

X

+ P[lacZ, ry+], CyKi D2-3, ry+XX + ry

Y +ry Y + ry

(Cy, Ki, ry+)

^

X

+P?+P?ryP?XX + ry

Y + ry Y + ry (not Cy, not Ki. If carrying

a jumped P, will be ry+)

^

X

Stain F2 for lacZ

Look for desired

expression pattern


Expt 10 1 p elements and enhancer trapping

We want to look at enhancer traps that express in the ovaries.


Expt 10 1 p elements and enhancer trapping

The Ovariole

Germarium

Germarium


Expt 10 1 p elements and enhancer trapping

The Ovariole


Expt 10 1 p elements and enhancer trapping

The Egg Chamber

Nurse Cells

Oocyte,

follicle cells


Expt 10 1 p elements and enhancer trapping

Staining Ovaries

Schematic Summary

  • Dissect ovaries out of abdomen in NaPO4 buffer (movie!).

  • Devitallinize with heptane

  • Fix ovaries and wash

  • Add X-GAL, the substrate for b-galactosidase.

  • Wash when dark enough, and observe.

  • We are using enhancer traps that express in

    • Follicle cells

    • Nurse cells and oocyte


  • Login