Expt. 10-1
Sponsored Links
This presentation is the property of its rightful owner.
1 / 29

Expt. 10-1 : P-elements and Enhancer Trapping PowerPoint PPT Presentation


  • 106 Views
  • Uploaded on
  • Presentation posted in: General

Expt. 10-1 : P-elements and Enhancer Trapping. Expt. 10: P-elements and Enhancer Trapping. Naturally occurring P-elements: Transposase gene between two inverted repeats. Transposase. 31 bp Inverted Repeat. Tnp Binding Site. 9 or 21 bp Spacer. Organization of the P Element.

Download Presentation

Expt. 10-1 : P-elements and Enhancer Trapping

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Expt. 10-1: P-elements and

Enhancer Trapping


Expt. 10: P-elements and

Enhancer Trapping

  • Naturally occurring P-elements: Transposase gene between two inverted repeats

Transposase


31 bp Inverted

Repeat

Tnp Binding

Site

9 or 21 bp Spacer

Organization of the P Element

Transposase ORF

2.9 kb P Element


NNNNNNNNNCATGATGAAATAACATA

NNNNNNNNN

3’-OH

5’-P

AGGTGG

GTACTACTTTATTGTATTCCACC

P -5’

HO-3’

Transposase catalyzes a 17bp staggered cleavage event

5’ Cleavage Site

NNNNNNNNNCATGATGAAATAACATAAGGTGG

NNNNNNNNNGTACTACTTTATTGTATTCCACC

3’ Cleavage Site


+

P Element


8 bp target site

duplication

P Element

P element integration generates an 8 bp target site duplication


Taking Advantage of P-elements

-Mutagenesis


Taking Advantage of P-elements

-Mutagenesis-Insertional mutations easy to clone.


Taking Advantage of P-elements

  • -MutagenesisInsertional mutations (easy to clone).

    • Imprecise excisions lead to frameshifts

    • and deletions.


Taking Advantage of P-elements

  • Germline transformation


Taking Advantage of P-elements

  • -Mutagenesis

  • Germline transformation

    • 1.Design transgene with inverted repeats.


Taking Advantage of P-elements

  • -Mutagenesis

  • Germline transformation

    • 1.Design transgene with inverted repeats.

    • 2.Mix with transposase gene


Taking Advantage of P-elements

  • -Mutagenesis

  • Germline transformation

    • 1.Design transgene with inverted repeats.

    • 2.Mix with transposase gene

    • 3.Inject into germline of embryo


Taking Advantage of P-elements

  • Germline transformation

    • 1.Design transgene with inverted repeats.

    • 2.Mix with source of transposase

    • 3.Inject into germline of embryo

    • 4.Look for transformants in F1.

YFG


Taking Advantage of P-elements

  • -Mutagenesis

  • Germline transformation

  • Enhancer trappingUse regulatory informationfrom nearby genes to drive expression of a transgene


Mechanics of Enhancer Trapping:

  • Modified P-element contains:

    • Inverted repeats

    • Basic promoter sequences

    • Molecular marker gene (e.g. b-galactosidase)

    • Phenotypic marker (e.g. w+, ry+)

  • Mobilize using transposase

  • Confirm hopping in F1 (phenotype)

  • Look for interesting/desired expression pattern in F2 with lacZ staining


Mechanics of Enhancer Trapping:

  • Modified P-element contains:

    • Inverted repeats

    • Basic promoter sequences

    • Molecular marker gene (e.g. b-galactosidase)

    • Phenotypic marker (e.g. w+, ry+)

  • Mobilize using transposase

  • Confirm hopping in F1 (phenotype)

  • Look for interesting/desired expression pattern in F2 with lacZ staining


Attached X females

^

XY X XXY


Attached X females

^

XY X XXY

^

XXX Sterile

^

XXYFemale

XYMale

YYDead


+ P[lacZ, ry+], Cy ry+ + Ki D2-3, ry+

+Sco ryY + +

X


+ P[lacZ, ry+], Cy ry+ + Ki D2-3, ry+

+ Sco ryY + +

X

+ P[lacZ, ry+], CyKi D2-3, ry+XX + ry

Y+ ryY + ry

(phenotype=Cy, Ki, ry+)


+ P[lacZ, ry+], Cy ry+ + Ki D2-3, ry+

+ Sco ryY + +

X

+ P[lacZ, ry+], CyKi D2-3, ry+XX + ry

Y +ryY + ry

(phenotype Cy, Ki, ry+)

^

X

^


+ P[lacZ, ry+], Cy ry+ + Ki D2-3, ry+

+ Sco ryY + +

X

+ P[lacZ, ry+], CyKi D2-3, ry+XX + ry

Y +ry Y + ry

(Cy, Ki, ry+)

^

X

+P?+P?ryP?XX + ry

Y + ry Y + ry

(not Cy, not Ki. If carrying

a jumped P, will be ry+)

^


+ P[lacZ, ry+], Cy ry+ + Ki D2-3, ry+

+ Sco ryY + +

X

+ P[lacZ, ry+], CyKi D2-3, ry+XX + ry

Y +ry Y + ry

(Cy, Ki, ry+)

^

X

+P?+P?ryP?XX + ry

Y + ry Y + ry (not Cy, not Ki. If carrying

a jumped P, will be ry+)

^

X

Stain F2 for lacZ

Look for desired

expression pattern


We want to look at enhancer traps that express in the ovaries.


The Ovariole

Germarium

Germarium


The Ovariole


The Egg Chamber

Nurse Cells

Oocyte,

follicle cells


Staining Ovaries

Schematic Summary

  • Dissect ovaries out of abdomen in NaPO4 buffer (movie!).

  • Devitallinize with heptane

  • Fix ovaries and wash

  • Add X-GAL, the substrate for b-galactosidase.

  • Wash when dark enough, and observe.

  • We are using enhancer traps that express in

    • Follicle cells

    • Nurse cells and oocyte


  • Login