Bioinformatics for human biologists
This presentation is the property of its rightful owner.
Sponsored Links
1 / 28

Bioinformatics for Human Biologists PowerPoint PPT Presentation


  • 49 Views
  • Uploaded on
  • Presentation posted in: General

Bioinformatics for Human Biologists. Rasmus Wernersson, Associate Professor Center for Biological Sequence Analysis, DTU [ [email protected] - http://www.cbs.dtu.dk/~raz/ ]. Course outline. DTU survival guide. This is a hands-on course. The major part of the course is computer exercises

Download Presentation

Bioinformatics for Human Biologists

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Bioinformatics for human biologists

Bioinformatics for Human Biologists

Rasmus Wernersson, Associate Professor

Center for Biological Sequence Analysis, DTU

[[email protected] - http://www.cbs.dtu.dk/~raz/]


Course outline

Course outline


Dtu survival guide

DTU survival guide


This is a hands on course

This is a hands-on course

  • The major part of the course is computer exercises

  • We get to use the actual methods

  • We get to use “live” online database

  • Reporting:

    • Short “log book” on each exercise


Everything is linked from the course programme

Everything is linked from the course programme


On evolution and sequences

Background information

On evolution and sequences


Classification linnaeus

Classification: Linnaeus

Carl Linnaeus

1707-1778


Classification linnaeus1

Classification: Linnaeus

  • Hierarchical system

    • Kingdom

    • Phylum

    • Class

    • Order

    • Family

    • Genus

    • Species


Classification depicted as a tree

Classification depicted as a tree


No mixed animals

No “mixed” animals

Source: www.dr.dk/oline


Classification depicted as a tree1

Classification depicted as a tree

Species

Genus

Family

Order

Class


Comparison of limbs

Comparison of limbs

Image source: http://evolution.berkeley.edu


Theory of evolution

Theory of evolution

Charles Darwin

1809-1882


Phylogenetic basis of systematics

Phylogenetic basis of systematics

  • Linnaeus:

    Ordering principle is God.

  • Darwin:

    Ordering principle is shared descent from common ancestors.

  • Today, systematics is explicitly based on phylogeny.


Natural selection darwin s four postulates

Natural Selection: Darwin’s four postulates

  • More young are produced each generation than can survive to reproduce.

  • Individuals in a population vary in their characteristics.

  • Some differences among individuals are based on genetic differences.

  • Individuals with favorable characteristics have higher rates of survival and reproduction.

  • Evolution by means of natural selection

  • Presence of ”design-like” features in organisms:

  • Quite often features are there “for a reason”


Evolution at the sequence level

Evolution at the sequence level


About dna

About DNA

  • DNA contains the recipes of how to make protein / enzymes.

  • Every time a cells divides it’s DNA is duplicated, and each daughter cell gets a copy.


The dna alphabet

The DNA alphabet

  • The information in the DNA is written in a four letter code: A, T, G, C.

  • The DNA can be “sequenced” and the result stored in a computer file.

  • ATGGCCCTGTGGAT


Dna is always written 5 3

Ribose

5

4

1

3

2

Deoxyribose

5

4

1

3

2

DNA is always written 5’  3’

3’

5’ AGCC 3’

3’ TCGG 5’

5’ ATGGCCAGGTAA 3’

5’

5’

3’

DNA backbone: http://en.wikipedia.org/wiki/DNA

(Deoxy)ribose: http://en.wikipedia.org/


Can dna be changed

Can DNA be changed?

  • ATGGCCCTGTGGATGCG


Can dna be changed1

Can DNA be changed?

  • ATGGCCCTGTGGATGCG

  • ATGGCCCTATGGATGCG


A history of mutations

A history of mutations

ATGGCAATGTGGATGCA

ATGGCCCCGTGGAACCG

ATGTCCCCGTGGATGCG

ATGGCCCCGTGGATGCG

ATGGCCCTGTGGATGCG

Time

ATGGCCCTGTGTATGCG


Dna alignment

6

5

3

“DNA alignment”

  • Species1: ATGGCAATGTGGATGCA

  • Species2: ATGGCCCCGTGGAACCG

  • Species3: ATGTCCCCGTGGATGCG


Real life example alignment

Real life example: Alignment

  • Insulin from 7 different species

  • Homo:ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAA

  • Pan:ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGTGCTGCTGGCCCTCTGGGGACCTGACCCAGCCTCGGCCTTTGTGAA

  • Sus:ATGGCCCTGTGGACGCGCCTCCTGCCCCTGCTGGCCCTGCTGGCCCTCTGGGCGCCCGCCCCGGCCCAGGCCTTCGTGAA

  • Ovis:ATGGCCCTGTGGACACGCCTGGTGCCCCTGCTGGCCCTGCTGGCACTCTGGGCCCCCGCCCCGGCCCACGCCTTCGTCAA

  • Canis:ATGGCCCTCTGGATGCGCCTCCTGCCCCTGCTGGCCCTGCTGGCCCTCTGGGCGCCCGCGCCCACCCGAGCCTTCGTTAA

  • Mus:ATGGCCCTGTTGGTGCACTTCCTACCCCTGCTGGCCCTGCTTGCCCTCTGGGAGCCCAAACCCACCCAGGCTTTTGTCAA

  • Gallus:ATGGCTCTCTGGATCCGATCACTGCCTCTTCTGGCTCTCCTTGTCTTTTCTGGCCCTGGAACCAGCTATGCAGCTGCCAA


Real life example tree

Real life example: Tree


Interpretation of multiple alignments

Interpretation of Multiple Alignments

Conserved features assumed to be important for functionality

For instance: conserved pairs of cysteines indicate possible disulphide bridge


Bioinformatics for human biologists

Sequences are related

  • Darwin: all organisms are related through descent with modification

  • Prediction: similar molecules have similar functions in different organisms

Protein synthesis carried out by very similar RNA-containing molecular complexes (ribosomes) that are present in all known organisms


Sequences are related ii

Sequences are related, II

Related oxygen-binding proteins in humans


  • Login