bioinformatics for human biologists
Download
Skip this Video
Download Presentation
Bioinformatics for Human Biologists

Loading in 2 Seconds...

play fullscreen
1 / 28

Bioinformatics for Human Biologists - PowerPoint PPT Presentation


  • 91 Views
  • Uploaded on

Bioinformatics for Human Biologists. Rasmus Wernersson, Associate Professor Center for Biological Sequence Analysis, DTU [ [email protected] - http://www.cbs.dtu.dk/~raz/ ]. Course outline. DTU survival guide. This is a hands-on course. The major part of the course is computer exercises

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Bioinformatics for Human Biologists' - vaughan


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
bioinformatics for human biologists

Bioinformatics for Human Biologists

Rasmus Wernersson, Associate Professor

Center for Biological Sequence Analysis, DTU

[[email protected] - http://www.cbs.dtu.dk/~raz/]

this is a hands on course
This is a hands-on course
  • The major part of the course is computer exercises
  • We get to use the actual methods
  • We get to use “live” online database
  • Reporting:
    • Short “log book” on each exercise
classification linnaeus
Classification: Linnaeus

Carl Linnaeus

1707-1778

classification linnaeus1
Classification: Linnaeus
  • Hierarchical system
    • Kingdom
    • Phylum
    • Class
    • Order
    • Family
    • Genus
    • Species
no mixed animals
No “mixed” animals

Source: www.dr.dk/oline

classification depicted as a tree1
Classification depicted as a tree

Species

Genus

Family

Order

Class

comparison of limbs
Comparison of limbs

Image source: http://evolution.berkeley.edu

theory of evolution
Theory of evolution

Charles Darwin

1809-1882

phylogenetic basis of systematics
Phylogenetic basis of systematics
  • Linnaeus:

Ordering principle is God.

  • Darwin:

Ordering principle is shared descent from common ancestors.

  • Today, systematics is explicitly based on phylogeny.
natural selection darwin s four postulates
Natural Selection: Darwin’s four postulates
  • More young are produced each generation than can survive to reproduce.
  • Individuals in a population vary in their characteristics.
  • Some differences among individuals are based on genetic differences.
  • Individuals with favorable characteristics have higher rates of survival and reproduction.
  • Evolution by means of natural selection
  • Presence of ”design-like” features in organisms:
  • Quite often features are there “for a reason”
about dna
About DNA
  • DNA contains the recipes of how to make protein / enzymes.
  • Every time a cells divides it’s DNA is duplicated, and each daughter cell gets a copy.
the dna alphabet
The DNA alphabet
  • The information in the DNA is written in a four letter code: A, T, G, C.
  • The DNA can be “sequenced” and the result stored in a computer file.
  • ATGGCCCTGTGGAT
dna is always written 5 3

Ribose

5

4

1

3

2

Deoxyribose

5

4

1

3

2

DNA is always written 5’  3’

3’

5’ AGCC 3’

3’ TCGG 5’

5’ ATGGCCAGGTAA 3’

5’

5’

3’

DNA backbone: http://en.wikipedia.org/wiki/DNA

(Deoxy)ribose: http://en.wikipedia.org/

can dna be changed
Can DNA be changed?
  • ATGGCCCTGTGGATGCG
can dna be changed1
Can DNA be changed?
  • ATGGCCCTGTGGATGCG
  • ATGGCCCTATGGATGCG
a history of mutations
A history of mutations

ATGGCAATGTGGATGCA

ATGGCCCCGTGGAACCG

ATGTCCCCGTGGATGCG

ATGGCCCCGTGGATGCG

ATGGCCCTGTGGATGCG

Time

ATGGCCCTGTGTATGCG

dna alignment

6

5

3

“DNA alignment”
  • Species1: ATGGCAATGTGGATGCA
  • Species2: ATGGCCCCGTGGAACCG
  • Species3: ATGTCCCCGTGGATGCG
real life example alignment
Real life example: Alignment
  • Insulin from 7 different species
  • Homo: ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAA
  • Pan: ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGTGCTGCTGGCCCTCTGGGGACCTGACCCAGCCTCGGCCTTTGTGAA
  • Sus: ATGGCCCTGTGGACGCGCCTCCTGCCCCTGCTGGCCCTGCTGGCCCTCTGGGCGCCCGCCCCGGCCCAGGCCTTCGTGAA
  • Ovis: ATGGCCCTGTGGACACGCCTGGTGCCCCTGCTGGCCCTGCTGGCACTCTGGGCCCCCGCCCCGGCCCACGCCTTCGTCAA
  • Canis: ATGGCCCTCTGGATGCGCCTCCTGCCCCTGCTGGCCCTGCTGGCCCTCTGGGCGCCCGCGCCCACCCGAGCCTTCGTTAA
  • Mus: ATGGCCCTGTTGGTGCACTTCCTACCCCTGCTGGCCCTGCTTGCCCTCTGGGAGCCCAAACCCACCCAGGCTTTTGTCAA
  • Gallus: ATGGCTCTCTGGATCCGATCACTGCCTCTTCTGGCTCTCCTTGTCTTTTCTGGCCCTGGAACCAGCTATGCAGCTGCCAA
interpretation of multiple alignments
Interpretation of Multiple Alignments

Conserved features assumed to be important for functionality

For instance: conserved pairs of cysteines indicate possible disulphide bridge

slide27

Sequences are related

  • Darwin: all organisms are related through descent with modification
  • Prediction: similar molecules have similar functions in different organisms

Protein synthesis carried out by very similar RNA-containing molecular complexes (ribosomes) that are present in all known organisms

sequences are related ii
Sequences are related, II

Related oxygen-binding proteins in humans

ad