From Big Data to Relevant data:
Download
1 / 18

From Big Data to Relevant data: Ribo-seq and its applications - PowerPoint PPT Presentation


  • 137 Views
  • Uploaded on
  • Presentation posted in: General

From Big Data to Relevant data: Ribo-seq and its applications Pasha Baranov "NGS Data after the Gold Rush“ Norwich, UK, May 2014. Porridge volume, log. time. What to sequence?. Lung cancer. Genetics: up to 2.4 higher chance than general population.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha

Download Presentation

From Big Data to Relevant data: Ribo-seq and its applications

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


From Big Data to Relevant data: Ribo-seq and its applications

Pasha Baranov "NGS Data after the Gold Rush“ Norwich, UK, May 2014

Porridge volume, log

time


What to sequence?

Lung cancer

Genetics: up to 2.4 higher chance than general population.

80-90% of lung cancer cases attributed to smoking.

DNA

RNA-seq

Median age of lung cancer occurrence in US is 70 years.

RNA

?

Protein


Ribosomal profiling (ribo-seq)

Ingolia et al (2009) Science 324: 218-23

Lysis, RNA digestion


Ribosomal profiling (ribo-seq)

Ingolia et al (2009) Science 324: 218-23

Lysis, RNA digestion

Density gradient or

cushion separation


Ribosomal profiling (ribo-seq)

Ingolia et al (2009) Science 324: 218-23

Lysis, RNA digestion

Density gradient or

cushion separation

Decircularization

Adaptor ligation

RT PCR

Circularization

Differential gene

expression analysis

Alignment to a reference sequence

Sequencing


mRNA level is only approximation of protein synthesis

Immediate response to oxidative stress (1 hour)

Andreev et al 2014 submitted


How do you know what is translated?

CTGGAAGAAGTAAACGCCGAGCTGGAACAGCCGGATGTCTGGAACGAACC

G R S K R RA G T A G C L E R T Frame 1

L E EV N A E L E Q P D V W N E P Frame 2

W K K* T P S W N S R M S G T N P Frame 3


Triplet periodicity

CAGCTAGTGCGTGCTGTC

123123123123123123


Triplet periodicity

CAGCTAGTGCGTGCTGTC

123123123123123123


Triplet periodicity

CAGCTAGTGCGTGCTGTC

123123123123123123


Triplet periodicity

CAGCTAGTGCGTGCTGTC

123123123123123123


Triplet periodicity

CAGCTAGTGCGTGCTGTC

123123123123123123


Triplet periodicity

CAGCTAGTGCGTGCTGTC

123123123123123123


Triplet periodicity

N+1

N+2

N+3


Switches between reading frames can be seen on ribosome profiles

Human Antizyme 1 mRNA

Michel et al 2012 Genome Res 22:2219-2229


uORFs & nORFs

Michel et al 2012 Genome Res 22:2219-2229


GWIPS-viz

http://gwips.ucc.ie


Acknowledgments

Dual coding:

Audrey Michel

University College Cork:

Choudhury, Atkins

Berkley: Ingolia

Cambridge: Firth

GWIPS-viz team:

Audrey Michel

Gearoid Fox

Patrick O'Connor

Stephen Heaphy

Paddy Mullan

Claire Donohue

Romika Saini

Zena Abbas

Oxidative stress work:

Dmitry Andreev

Patrick O’Connor

Moscow State University:

Terenin, Dmitriev, Shatsky

Trinity College Dublin:

Kenny, Fahey, Cormican, Morris

Financial resources:


ad
  • Login