slide1
Download
Skip this Video
Download Presentation
Sequencing the Euchromatic Region of Chromosome 5 of Tomato

Loading in 2 Seconds...

play fullscreen
1 / 21

Sequencing the Euchromatic Region of Chromosome 5 of Tomato - PowerPoint PPT Presentation


  • 97 Views
  • Uploaded on

Sequencing the Euchromatic Region of Chromosome 5 of Tomato. International Tomato Genome Sequencing Project. Country. USA. Korea. China. UK. India. NL. France. Japan. Spain. USA. USA. Italy. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. Chromosome. Mb. 24. 26. 26. 19. 12.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Sequencing the Euchromatic Region of Chromosome 5 of Tomato' - varick


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide2

International Tomato Genome Sequencing Project

Country

USA

Korea

China

UK

India

NL

France

Japan

Spain

USA

USA

Italy

1

2

3

4

5

6

7

8

9

10

11

12

Chromosome

Mb

24

26

26

19

12

20

27

17

16

10

13

11

T=220

To sequence

BACs

246

268

274

193

111

213

277

175

164

108

135

113

T=2276

0 µm

53.8 Mb

64.7 Mb

64.7 Mb

80.0 Mb

82.1 Mb

80.3 Mb

81.8 Mb

76.4 Mb

83.6 Mb

85.6 Mb

88.5 Mb

Euchromatin

108.0 Mb

Heterochromatin

70 µm

slide3

National Research Centre for Plant Biotechnology

National Institute for Plant Genome Research

Nagendra K. Singh

T. Mohapatra

T. R. Sharma

K. Gaikwad

Debasis Chattopadhyay

Sabhyata Bhatia

Indian Initiative on Tomato Genome Sequencing

Telomeric Region

University of Delhi South Campus

Akhilesh K. Tyagi

J. P. Khurana

P. Khurana

Arun Sharma

Euchromatic Region

UDSC

&

NIPGR

(0-60 cM)

Heterochromatic Region

Centromeric Region

Heterochromatic Region

NRCPB

(69-119 cM)

Euchromatic Region

Telomeric Region

slide4

Confirmation of marker CT101 and its assigned seed BAC position on chromosome 5

Marker:CT101

Seed BAC:LE_HBa0191B01

Haplotype 1: -ACCCCTCAATATTTCGCTCCAA

Haplotype 2:TGTATACTTGCGCCAGTTCAGGG

Haplotype 1: M82, IL 5-2, IL 5-3, IL 5-4,

IL 5-5, LE_HBa0191B01

Haplotype 2: L. pennellii, IL 5-1

(M82)

L. esculentum

L. pennellii

IL 5-1

IL 5-2

IL 5-3

IL 5-4

IL 5-5

slide6

Mapping of BAC clones on chromosome 5 using FISH

Chromosome 5

0 cM

UDSC + NIPGR

30 cM

BAC: LE_HBa0189E17 Marker: T0564 at 11 cM

60 cM

90 cM

NRCPB

BAC: LE_HBa0138J03 Marker: T1746 at 84 cM

119 cM

slide7

The path for genomic sequencing

Single streak of BAC clones from seed BAC library

DNA extraction

DNA fingerprinting

(HindIII-digested)

for BAC stock purity

CHEF-analysis

for size estimation

PCR with genetic marker

for re-confirmation

IL-mapping for chromosome 5-specificity

presence of SNP/indels

Polymorphism in PCR (digested) products

Haplotype

1 TACGTG...TTAT

2 CGAACAI/DGACA

1: M82, IL 5-2, IL 5-3, IL 5-4,

IL 5-5, seed BAC

2: L. pennellii, IL 5-1

Shotgun cloning and sequencing

Assembly of sequence

BAC annotation

Selection of extension BAC

Searching for STCs (Sequence Tag Connector) SGN end-sequence database

Overgo hybridization

slide8

Status

Clones selected

Marker

cM

Phase III

LE_HBa0191B01

CT101

0

Phase II

SL_MboI0050C14

Telomeric Region

Phase I

SL_MboI0004P04

T1181

0

Phase II

SL_EcoRI0101I15

T1632

0

Phase III

SL_MboI0005B15

Phase III

SL_EcoRI0086I08

Phase III

LE_HBa0261K11

C2_At1g60200

7

Phase III

LE_HBa0042B19

cLET-8-B23

10

Phase II

LE_HBa0189E17

T0564

11

Euchromatic Region

Phase I

SL_MboI0079D24

Short Arm

Phase I

LE_HBa0115F01

Phase II

SL_MboI0095J08

UDSC & NIPGR

Phase III

SL_MboI0037H06

Phase II

LE_HBa0179E24

cLED-8-G3

15.5

Phase III

LE_HBa0058L13

CT242

Phase III

LE_HBa0060G21

T1592

16

Phase II

SL_EcoRI0066O01

TG441

Phase III

LE_HBa0145P19

TG432

Phase III

LE_HBa0003C20

BS4

44

Phase III

LE_HBa0168M18

CT167

Heterochromatic Region

Library

SL_MboI0118J18

Phase III

SL_EcoRI0028N03

Phase III

SL_EcoRI0122H05

Phase II

LE_HBa0309L13

C2_At2g01110

37

Phase II

SL_EcoRI0037P02

Centromeric Region

Phase II

C2_At3g55120

44

SL_EcoRI0082N07

Phase I

SL_MboI0115G01

C2_At4g24830

51

57

Phase I

SL_MboI0079C22

T1640

LE_HBa0057G22

Phase II

60

TG96

Phase II

LE_HBa0298C03

73

Heterochromatic Region

Phase I

LE_HBa0169M21

T1360

Library

LE_HBa0201O22

Library

LE_HBa0135A02

C2_At1g10500

76

Library

LE_HBa0009H01

Phase II

LE_HBa0138J03

T1746

84

Library

SL_MboI0093K24

Long Arm

Library

SL_EcoRI0015E23

CT172

Library

SL_EcoRI0065K15

C2_At2g31970

Library

SL_MboI0018L12

Phase II

LE_HBa0166A02

T1777

105

NRCPB

Phase II

LE_HBa0040C21

T1541

107

Phase II

LE_HBa0025A19

Euchromatic Region

Phase II

LE_HBa0131D04

T1584

108

Phase II

LE_HBa0196G23

Phase II

LE_HBa0141A12

Phase II

LE_HBa0239D11

CT130

115

Phase I

SL_EcoRI0019P03

Phase II

LE_HBa0251J13

TG185

119

Library

LE_HBa0089M06

Phase II

LE_HBa0076P16

CT138

119

Library

LE_HBa0056N10

Telomeric Region

Sequencing status of BAC clones from short arm of chromosome 5

slide9

BAC sequence available in GenBank with keywords TOMGEN, ITAG

Repeat Masking and removal of contaminants

STRUCTURAL

Gene predictions by

FGENESH,GeneMark,GlimmerHMM

Alignments with ESTs

EuGene

Unified gene models

InterPro, BLASTP, GO

Batch001 (10 BACs)

Batch002 (57 BACs)

FUNCTIONAL

SwissProt V52

TAIR V6

RAP- db Build4

first significant hit (<e-5)

Outputs uploaded in gff3 and txt file formats

Annotation of tomato genome

slide10

Highlights

1. All BAC clones are being mapped on chromosome 5 by using chromosome 5-specific introgression lines

2. Presently, 51 BAC clones, covering approximately ~4.6 Mb region, have been mapped and are in the sequencing pipeline

3. Current status of BAC clones from chromosome 5, selected for sequencing

* Thirteen BAC clones in phase III (8 submitted to NCBI)

* Twenty BAC clones in phase II (10 submitted to NCBI)

* Eight BAC clones in phase I

* Ten BAC clones at various stages of library preparation

and sequencing

4. Of the ten BAC clones sent for FISH at Stephen Stack’s laboratory, Colorado, seven have been mapped on Chromosome 5

5. Novel CAPS markers are being used to map BACs that have been selected on the basis of ORFs at both ends

6. Functional annotation of proteins predicted by Eugene is being carried out as a participating member of ITAG

slide11

Designing primers from either/both BAC ends

PCR amplification from S. pennellii and S. lycopersicum

Sequencing of S. pennellii PCR amplified product

Comparison for SNPs

Designing CAPS marker

PCR amplification from parents and chromosome-wise IL pools

Restriction digestion of PCR product from parents and 12 chr. IL pools

Validation by individual ILs from specific chromosome

Procedure for the confirmation of BACs on tomato chromosomes using CAPS markers in Introgression Lines

slide12

100 bp ladder

S. lycopersicum

S. pennellii

Chromosome 1

Chromosome 2

Chromosome 3

Chromosome 4

Chromosome 5

Chromosome 6

Chromosome 7

Chromosome 8

Chromosome 9

Chromosome 10

Chromosome 11

Chromosome 12

1 kb ladder

100 bp ladder

S. lycopersicum

S. pennellii

Chromosome 1

Chromosome 2

Chromosome 3

Chromosome 4

Chromosome 5

Chromosome 6

Chromosome 7

Chromosome 8

Chromosome 9

Chromosome 10

Chromosome 11

Chromosome 12

1 kb ladder

Confirmation of a BAC clone HBa0024M22 on tomato chromosome 5 using ILs

Digestion of PCR amplified products with Eco RV

slide14

Contributors

IITGS

UDSC

NRCPB

NIPGR

Prof. Akhilesh K. Tyagi

Prof. J. P. Khurana

Prof. P. Khurana

Dr. A. K. Sharma

Dr. Vikrant Gupta 

Dr. Saloni Mathur

Dr. Shailendra Vyas

Mr. Amol Solanke

Mr. Rahul Kumar

Ms. Rashmi Jain

Mr. Rupesh K Jain

Mr. Shaji Joseph V

Dr. Nagendra K. Singh

Dr. T. Mohapatra

Dr. T. R. Sharma

Dr. K. Gaikwad

Dr. Kamlesh Batra

Dr. Archana Singh 

Dr. Mahavir Yadav 

Dr. Rekha Dixit 

Dr. Pradeep K. Singh 

Mr. Vivek Dalal 

Ms. G. Chitra

Mr. Awadhesh Pandit

Mr. Sambit P. Sahoo 

Mr. Shashi B. Ojha

Dr. Debasis Chattopadhyay

Dr. Sabhyata Bhatia

Dr. S. Dewan

Ms. P. Chowdhury

S. Shridhar

slide15

Criteria for BAC selection and confirmation

  • Selection of two candidate seed BACs on chromosome 5
  • specific marker
      • 100 kb or more in size
      • end sequence availability at SGN
  • 2. Purity check of bacterial stock
      • Hind III fingerprint of DNA isolated from six independent colonies
  • 3. PCR amplification of genetic markers/overlapping region
      • two marker/overlapping region-specific primer pairs
  • 4. BAC verification by direct sequencing
      • using two marker/overlapping region-specific primers
      • using vector-specific SP6 and T7 primers
  • 5. Size estimation/confirmation of BAC clone
      • by CHEF analysis of Not I digested BAC DNA
  • 6. Validation of BAC on chromosome 5 using Introgression Lines
      • polymorphism in PCR products
      • SNP detection of non-polymorphic bands
slide16

BACs mapped on chromosome 7

Chromosome 7

SP6

SP6

SP6

SP6

T7

HBa0144B20

HBa0123J08

HBa0064M20

HBa0102G23

HBa0188L22

SP6

Primer pair 1

~1.4 kb overlap

SP6

Primer pair 2

~3.5 kb overlap

T7

T7

T7

T7

MboI0077G20 (92 kb)

SP6

T1401 (COS)

95 cM

Primer pair 1

12955 bp overlap (100%)

CT223 (RFLP)

T7

HBa0179K09 (108 kb)

T7

Primer pair 1

9002 bp overlap (100%)

Clones sequenced to Phase III level

T7

Clones sequenced to Phase II level

MboI0032F07 (~140 kb)

SP6

Extension clones verified

T7

Red bars indicate the PCR positive nature of BAC clones using respective primer pairs

~19 kb overlap

Primer pair 2

~15.5 kb overlap

Primer pair 1

SP6

Dotted line indicates the expected overlap

MboI0052O23

MboI0083J01

Blue line shows the presence of mapped markers on the BAC clones

SP6

T7

slide18

Confirmation of BAC position on chromosome 5 using Introgression Lines

Designing primers from marker or BAC-specific sequences

PCR amplification from genomic DNA of L. esculentum, L. pennellii and ILs of chromosome 5

Exo-SAP treatment to amplified PCR product

Sequencing of PCR products with both Forward and Reverse primers

Alignment of generated sequences

Search of SNPs/InDels in ILs with respect to parents

ad