유산균의 동정 및 김치 유산균의 다상 연구
This presentation is the property of its rightful owner.
Sponsored Links
1 / 54

유산균의 동정 및 김치 유산균의 다상 연구 PowerPoint PPT Presentation


  • 474 Views
  • Uploaded on
  • Presentation posted in: General

유산균의 동정 및 김치 유산균의 다상 연구. 한국생명공학연구원 생물자원센터 유전자은행 이정숙. Lactic acid bacteria.

Download Presentation

유산균의 동정 및 김치 유산균의 다상 연구

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


4490540

유산균의 동정 및 김치 유산균의 다상 연구

한국생명공학연구원

생물자원센터

유전자은행

이정숙


4490540

Lactic acid bacteria

Gram-positive, non spore-forming, catalase-negative, devoid of cytochromes, of nonaerobic habit but aerotolerant, fastioius, acid-tolerant, cocci or rods, which produce lactic acid as a major sole end product of the fermentation of sugar


4490540

Consist of several genera including Aerococcus, Alloiococcus, Carnobacterium, Dolosigranulum, Enterococcus, Globicatella, Lactobacillus, Lactococcus, Lactosphaera, Leuconostoc, Oenococcus, Pediococcus, Streptococcus, Tetragenococcus, Vagococcus, and Weissella (16 genera)


4490540

The lactic acid bacteria are of paramount importance in the food industry, both as beneficial organisms and as spoilage organisms. They are used in the production of fermented milk products such as yogurt, sour cream, cheese and butter, and in the production of sausage, pickles, sauerkraut and kimchi. The results of these fermentations are more shelf-stable products with characteristic aromas and flavors. If the growth of lactic acid bacteria is not in some way controlled, they can be a major cause of food spoilage. The souring of milk and the greening of meat are common examples of spoilage resulting from the unchecked activity of these organisms.


4490540

Differential characteristics of lactic acid bacteria

Character

Rods

Cocci

Carnob.

Lactob.

Aeroc.

Enteroc.

Lactoc.

Vagoc.

Leuconoc.

Oenoc.

Pedioc.

Streptoc.

Tetragenoc.

Weissella

Tetrad formation

-

-

+

-

-

-

+

-

+

-

CO2 from glucose

-

±

-

-

-

+

-

-

-

+

Growth at 10ºC

+

±

+

+

+

+

±

-

+

+

Growth at 45ºC

-

±

-

+

-

-

±

±

-

-

Growth at 6.5% NaCl

ND

±

+

+

-

±

±

-

+

±

Growth at 18% NaCl

-

-

-

-

-

-

-

-

+

-

Growth at pH 4.4

ND

±

-

+

±

±

+

-

-

±

Growth at pH 9.6

-

-

+

+

-

-

-

-

+

-

Lactic acid

L

D, L, DL

L

L

L

D

L, DL

L

L

D, DL


4490540

Schematic, unrooted phylogenetic tree of the lactic acid bacteria, including some aerobic and facultatively Gram-positives of the low G+C subdivision.

Note: evolutionary distances are approximate.

(Lactic Acid Bacteria: microbiology and functional aspects/ edited by Seppo Salminen & Atte von Wright. 2nd ed.)


4490540

Lactic acid bacteria 분류, 동정의 문제점

  • 동일한 선택 배지에서 생육이 가능하며 생리생화학적 특성에 따른 명확한 구분이 어렵다.

  • 16S rRNA sequence 분석을 통한 분자분류학적 연구 결과로부터 genus간의 혼재되는 양상이 보고되었고, 새로운 genus로의 전이가 진행중이다.


4490540

분류학 연구의 목적

  • 기존의 미생물 분류체계 확립

  • 분리균의 정확한 동정

  • 새로운 유용한 미생물의 발견


Bacterial systematics

Bacterial systematics 의 최근 동향

  • Polyphasic taxonomy

  • 분자계통분류 (Molecular systematics)

  • 신속 동정

  • 재분류

  • 새로운 유용한 유전자의 응용


4490540

Type of modern bacterial systematics

Numerical taxonomy

Phenotypic data

Molecular systematics

Chemotaxonomy

Protein analysis

Cell wall composition

Whole-organism fingerprinting

Nucleic acid sequencing

RFLP

RAPD


4490540

Molecular systematic and Chemosystematic analyses of the bacteria cell, and the taxonomic level at which they are generally most useful

Cell components

Analyses & Methods

Taxonomic ranks covered

Chromosomal DNA

Base composition(mol% G+C)

DNA:DNA hybridsation

DNA restriction patterns

rRNA RFLP(ribotyping)

Genus

Species

Species and subspecies

Ribosomal RNA

Nucleotide sequence

DNA:rRNA hybridsation

Species and subspecies

Genus and above

Protein

Amino acid sequence

Serological comparisons

Electrophoretic patterns

Species and genus

Cell walls and membranes

Peptidoglycan structure

Polysaccharides

Teichoic acids

Fatty acids

Polar lipids

Mycolic acids

Isoprenoid quinones

Genus and species

Species and subspecies

Genus and species

Metabolic produces

Fatty acids

Species and subspecies

Complete cell

Pyrolysis mass-spectrometry

Rapid enzyme tests

Genus, species and below

Species and subspecies

( modified from Priest and Austin, 1993)


4490540

분자계통분류

  • 환경적 요인에 영향을 받지 않음

  • 많은 세균의 재분류의 기반 조성

  • 종 (species) 을 정의


Species

세균 분류학에서의 종 (species)이란?

  • 분류학에서의 정의가 가능한 기본 단위

  • DNA-DNA 상동성이 70% 이상인 균주들

    (70% 이하일 경우 다른 종)

    - 1987 국제세균분류위원회

    *16S rRNA gene 상동성 97% 이하 DNA-DNA 상동성이 60% 이하  다른 종

    (Stackebrandt & Goebel, 1994)


4490540

새로운 유전자의 필요성

  • 16S rRNA gene 및 DNA-DNA 상동성의 단점

    - 16S rRNA gene

    : 유연관계가 가까운 균주의 비교에는 적당치 않음

    - DNA-DNA 상동성

    : 실험상의 어려움

  • 다른 유전자가 새로운 정보를 줄 수도 있음


16s rrna gene in molecular systematics

16S rRNA gene in molecular systematics

  • 모든 세균에 존재

  • 염기서열의 variable region과 conserved region의 분산 존재

  • 많은 균주의 염기서열이 결정되어 있음


4490540

Chemotaxonomy

분석기기

발달

컴퓨터

발달


4490540

균체지방산 조성 분석

- 세포 지질의 필수 구성성분으로 모든 미생물에 존재

- 10 - 24개 정도의 carbon chain으로 이루어져 있으며 그들의 길이, 이중결합의 위치, 치환기 등에 따라 다양한 형태로 존재

- 최근에는 Microbial Identification System (MIDI; Microbial ID, Inc., Newark, Del., USA) 이라는 Automated Gas Chromatography로 분석


4490540

Fatty acids found in bacteria.


4490540

HARVESTING

Third Quadrant

4

mm Loop

Coat Bottom

SAPONIFICATION

°

Vortex

°

100

C

Add 1.0 ml

100

C 5 min

Vortex

5-10 sec

25 min cool

Reagent # 1

5-10 sec

METHYLATION

°

80

1

C , 10

±

±

Add 2.0 ml

Vortex 5-10 sec

1

minCool apidly

Reagent # 2

EXTRACTION

Remove Bottom

Add1.25 ml

Save Top Phase

10

min

Phase

Reagent # 3

WASH

Remove 2/3

Cap

Transfer to

Add 3.0 ml

5

min

Top Phase

GC Vial

Reagent # 4


4490540

95개 탄소원 이용성 분석 (BIOLOG system)

95개의 탄소원 이용성을 분석하여 미생물의 동정과 분류에 응용하는 자동화 시스템


4490540

Biolog GP microplate

water

α-cyclodextrin

β-cyclodextrin

dextirn

glycogen

inulin

mannan

tween 40

tween 80

N-acetyl-D-glucosamine

N-acetyl-D-mannosamine

amygdalin

L-arabinose

D-arbitol

arbutin

cellobiose

D-fructose

L-fucose

D-galactose

D-galacturonic acid

gentiobiose

D-gluconic acid

α-D-glucose

m-inositol

α-D-lactose

lactulose

maltose

maltotriose

D-mannitol

D-manose

D-melezitose

D-melibiose

α-methyl D-galactoside

β-methyl D-galactoside

3-methyl glucose

α-methyl D-glucoside

β-methyl D-glucoside

α-methyl D-mannoside

palatinose

D-psicose

D-raffinose

L-rhamnose

D-ribose

salicin

sedoheptulosan

D-sorbitol

stachyose

sucrose

D-tagalose

D-trehalose

turanose

xylitol

D-sylose

acetic acid

α-hydroxybutyric acid

β-hydroxybutyric acid

γ-hydroxybutyric acid

ρ-hydroxyphenyl acetic acid

α-keto glutaric acid

α-keto valeric acid

lactamide

D-lactic acid methylester

L-lactic acid

D-malic acid

L-malic acid

methyl pyruvate

mono-methyl succinate

propionic acid

pyruvic acid

succinamic acid

succinic acid

N-acetyl L-glutamic acid

alaninamide

D-alanine

L-alanine

L-alanyl-glycine

L-asparagine

L-glutamic acid

glycyl-L-glutamic acid

L-pyroglutamic acid

L-serine

putrescine

2,3-butanediol

glycerol

adenosine

2'-deoxy adenosine

inosine

thymidine

uridine

adenosine-5'-monophosphate

tymidine-5'-monophosphate

uridine-5'-monophosphate

fructose-6-phosphate

glucose-1'-phosphate

glucose-6-phosphate

D-L-α-glycerol phosphate


4490540

DNA 염기 조성 분석

  • DNA 염기 조성은

  • mol % G+C로 표기

  • 미생물의 전체 DNA 염기 조성에서 Guanine (G)과 Cytosine (C)이 차지하는 상대적 비율을 나타내며 미생물마다 고유의 조성을 가짐

  • 미생물의 속 (genus)과 종 (species)을 기술하는 최소 요건 중 하나로 이용


4490540

  • 세균의 DNA 염기조성의 차이 : 24 - 76 mol %

  • 분석 방법 : Tm법, Bd법, HPLC법

  • G+C mol % 차이

  • 5% 이상 : 다른 종

  • 10% 이상 : 다른 속


4490540

G+C content of taxa taken to represent the main

lines of descent of procaryotes


4490540

Weissella koreensis sp. nov., isolated from kimchi


4490540

Morphological and physiological characteristics

irregular short or coccoid rods

Gram-positive, catalase-negative and facultative anaerobes

grew at 10 and 37 C but not at 42 C (optimum temperature : 25 C)

grew at pH 4.0-8.0 (optimum pH : pH 6.0)

Chemotaxonomic characteristics

Cell wall type : Lys-Ala-Ser

Major whole-cell fatty acids : octadecenoic acid (18:1) and hexadecanoic acid (16:0)

DNA base compositions : 37 mol%

DNA-DNA reassociation analysis

Phylogenetic analysis


4490540

Characteristic

W. kandleri*

W. viridescens*

W. minor*

W. halotolerans*

W. confusa*

W. paramesenteroides*

W. hellenica*

W. thailandensis*

S-5623T

S-5673

Acid produced from:

L-Arabinose

-

-

-

-

-

d

+

+

+

+

Cellobiose

-

-

+

-

+

(d)

-

-

-

-

Galactose

+

-

-

-

+

+

-

+

-

-

Maltose

-

+

+

+

+

+

+

+

-

-

Melibiose

-

-

-

-

-

+

-

+

-

-

Raffinose

-

-

-

-

-

d

-

+

-

-

Ribose

+

-

+

+

+

d

-

+

+

+

Sucrose

-

d

+

-

+

+

+

+

-

-

Trehalose

-

d

+

-

-

+

+

+

-

-

Xylose

-

-

-

-

+

d

-

-

+

+

Hydrolysis esculin

-

-

+

-

+

(+)

ND

+

-

-

NH3 from arginine

+

-

+

+

+

-

-

-

+

+

Dextran formation

+

ND

-

ND

+

-

-

-

+

+

Lactic acid configuration

DL

DL

DL

DL

DL

D

D

D

D

D

Murein type

Lys-Ala-Gly-Ala2

Lys-Ala-Ser

Lys-Ser-Ala2

Lys-Ala-Ser

Lys-Ala

Lys-Ala;

Lys-Ser-Ala2

Lys-Ala-Ser

Lys-Ala2

Lys-Ala-Ser

Lys-Ala-Ser

Cell Morphology

Irregular rods

Small irregular rods

Irregular short coccoid rods with rounded to tapered ends

Irregular short or coccoid rods

Short rods thickened at one end

Spherical or lenticular cells

Large spherical or lenticular cells

Cocci in pairs or in chains

Irregular short or coccoid rods

Irregular short or coccoid rods

G + C content (mol%)

39

41-44

44

45

45-47

37-38

39-40

38-41

37

37

Differential Characteristics of species of the genus Weissella.


4490540

Scanning electron micrograph of strain S-5623T. Bar, 1m.


4490540

Leuconostoc argentinum DSM 8581T (AF175403)

970

Leuconostoc lactis JCM 6123T (AB023968)

990

Leuconostoc citreum KCTC 3526T (AF111948)

712

Leuconostoc kimchii KCTC 3286T (1F173986)

930

Leuconostoc gelidum DSM 5578T (AF175402)

Leuconostoc carnosum NCFB 2776T (X95977)

1000

Leuconostoc mesenteroides subsp. cremoris DSM 20346T (M23034)

1000

Leuconostoc mesenteroides subsp. mesenteroides DSM 20343T (M23035)

934

Leuconostoc pseudomesenteroides NCDO 768T (X95979)

Leuconostoc fallax DSM 20189T (S63851)

Oenococcus oeni ATCC 23279T (M35820)

Weissella paramesenteroides DSM 20288T (M23033)

998

Weissella thailandensis FS61-1T (AB023838)

976

Weissella hellenica NSFB 2973T (X95981)

Weissella confusa DSM 20196T (M23036)

1000

Weissella minor DSM 20014T (M23039)

1000

Weissella viridescens DSM 20410T (M23040)

Weissella halotolerans DSM 20190T (M23037)

Weissella koreensis S5673 (AY035892)

1000

Weissella koreensis S5623T (AY035891)

992

Weissella kandleri DSM 20593T (M23038)

Lactobacillus kimchii KCTC 8903PT (AF183558)

828

Lactobacillus .plantarumNCDO 1753T (X52653)

999

928

Lactobacillus brevis ATCC 14869T (M58810)

Lactobacillus delbrueckii subsp. delbtueckii ATCC 9649T (M58814)

Escherichia coli (V00348)

0.1

Phylogenetic relationships between Weissella koreensis S5623T, S5673, Weissella species and other related bacteria based on 16S rDNA sequences. The branching pattern was generated by the neighbour-joining method. The numbers indicate bootstrap values > 700. The scale bar indicates 0.1 nucleotide substitutions per nucleotide position.


4490540

Species

% Reassociation with labeled DNA from:

S-5673

S-5623T

KCTC 3610T

KCTC 3504T

S-5673

100

103

25

16

S-5623T

90

100

24

16

W. Kandleri KCTC 3610T

21

20

100

14

W. viridescens KCTC 3504T

13

16

9

100

DNA-DNA reassociation values between S-5623T, S-5673, W. kandleri KCTC 3610Tand W. viridescens KCTC 3504 T.


4490540

Description of Weissella koreensis sp. nov. Weissella koreensis (ko.re.ensis N. L. adj. koreensis, for Korea, which the new organisms were isolated)

Cells are irregular short rod-shaped or coccoid organism. Gram-positive, non-motile, non-spore-forming, catalase-negative and facultative anaerobes. Grows at 10 and 37 C and pH 4.0-8.0 but not at 42C. The optimum temperature and pH for growth were 25C and 6.0, respectively. They did not grow in 8% and 10% NaCl. Arginine is hyrolysed and dextran from sucrose is formed. D(-)-lactic acid and gas from glucose are produced. Acid is produced from L-arabinose, ribose and xylose, but not from cellobiose, galactose, maltose, melibiose, raffinose, sucrose and trehalose.

The G+C content of the DNA is 37 mol %. Lys-Ala-Ser in the cell walls. Major cellular fatty acids are C18:1 7cand C16:0.

Source: kimchi, Korean traditional fermented vegetable food.

The type strain is S-5623T (= KCTC 3621T = KCCM 41516T = JCM 11263T), and reference strain includes S-5673 (= KCTC 3622 = KCCM 41517 = JCM 11264).


4490540

Polyphasic Study for Monitoring of the Lactic Acid Bacterial Communities during Kimchi Fermentation


4490540

연구의 목적

  • 김치 발효 과정에서의 젖산균의 다양성과 변화 분석

  • 김치유래 젖산균의 분류•동정


4490540

Culture-dependent approach for diversity and dynamics of the microbial communities during kimchi fermentation


4490540

Analysis of FAMEs of isolates from MRS medium

A great diversity of fatty acid, at least 37 different ones, was detected in the isolates from kimchi, but 15 of them appeared in less than 5% of the strains tested and will not be considered in detail further.

Four fatty acids such as C14:0, C16:0, C18:1 ω9c, and summed feature 7 appeared in all strains tested. Four fatty acids such as C16:1 ω7c,C18:0, C19:0 CYCLO ω8c, and Summed feature 9 appeared in more than 70% of the strains tested.

Cluster analysis revealed 7 major FANE clusters and 1 single cluster that are presented in an abridged dendrogram. The clusters defined at Euclidian distance of 17.5.

Analysis of FAMEs of isolates from PES medium

The fatty acid compositions of the 79 presumptive Leuconostoc strains were determined. Three of the 28 different fatty acid types were excluded from the final data analysis since these were detected in less than 5% of the strains

All 79 strains contained C14:0, C16:0, C18:0, C18:1 ω9c, summed feature 4, and summed feature 7. Seven fatty acids such as C15:0, C16:1 ω5c, C17:1 ω8c, C19:1 iso, C19:0 CYCLO ω8c, summed feature 6, and summed feature 9 appeared in more than 70% of the strains tested.

All 79 strains were identified to known clusters, i.e. B, C and D, at a Euclidian distance of 17.5.


4490540

Euclidian distance

30.00

20.00

10.00

0.00

Cluster

Number of strains

Identity

A

6

Leu. mesenteroides subsp. dextranicum

B

61

Leuconostoc sp.

Leu. citreum

Leu. pseudomesenteroides

C

79

Lab. delbruekii subsp. delbruekii

Lab. casei

G

8

Lab. plantarum

Lab. parabuchneri

F

28

Lab. plantarum

Lab. animalis

Lab. brevis

E

F

21

H

1

Leuconostoc sp.

Leu. mesenteroides subsp. mesenteroides

Leu. mesenteroides subsp. cremoris

Leu. carnosum

Leu. lactis

D

24

Dendrogram showing the relationship between the isolates from MRS medium based on their cellular fatty acid profiles.


4490540

Analysis of carbon-source utilization patterns of isolates from MRS medium

The test strains were recovered in five major, one minor and twelve single clusters defined at the SSM level of 80%.

Analysis of carbon-source utilization patterns of isolates from PES medium

All 75 strains were identified to known clusters, i.e. M, N, O and P, at the SSM level of 80%.


4490540

Number of

strains

Percentage Similarity

Cluster

Identity

50 60 70 80 90 100

R

2

Lactobacillussp.

M

54

Leu. ameliobiosum

N

59

Leu. m. mesenteroides

Lab. plantarum

Lab. d. delbrueckii

Lab. casei

Q

20

S5386

Leuconostoc sp.

Leu. pseudomesenteroides

Leu. lactis

Lab. animalis

Lab. brevis

Lab. parabuchneri

O

25

S3

S136

S5486

S185

S176

Leuconostoc sp.

Leuconostoc sp.

Lactobacillus sp.

11

P

KCTC3526

Leu. citreum

S123-2

S178

S5299

S199

Leuconostoc sp.

S5393

Abridged dendrogram showing the relationships between the isolates from MRS medium defined in the SSM, UPGMA analysis.


4490540

  • 균체지방산 조성 분석이나 탄소원 이용성 분석에 따라 lactic acid bacteria의 그룹화가 이루어지며, 이에 따른 데이터베이스를 구축할 수 있다. 그리고 분리균주를 각각의 데이터베이스와 비교하여 분류하는 것도 가능하다.

  • 그러나, 두가지 방법에 따른 데이터베이스 상호간의 일치점을 명확히 규명하기는 어렵다.

  • Culture-dependent methods의 한계점을 극복할만한 새로운 측면의 연구 방법 모색이 필요하다.


4490540

Molecular monitoring for diversity and dynamics of the microbial communities during kimchi fermentation


4490540

Denaturing Gradient Gel Electrophoresis (DGGE)

DGGE is based on the principle that increasing denaturant concentration will melt double-stranded DNA in distinct domains. When the melting temperature (Tm) of the lowest domain is reached, the DNA will partially melt, creating branched molecules with reduced mobility in a polyacrylamide gel. The denaturing environment is created by a uniform run temperature between 50 and 65C and a linear denaturant gradient formed with urea and formamide. The gradient may be formed perpendicular or parallel to the direction of electrophoresis. DGGE is one of the most sensitive mutation detection methods, providing efficiency up to 99%. Based on this principle, DGGE is used to be a suitable tool for the study of microbial diversity.


4490540

Perpendicular denaturing gradient gel in which the denaturing gradient is perpendicular to the electrophoresis direction.

This shows a single melting domain. At low denaturant concentration (left) the DNA fragment remains double stranded, but as the concentration increases (moving right) the DNA fragment begins to melt, creating a branched molecule. At very high concentrations, the DNA fragment can completely melt, creating two single strands. (Upper)

A, Perpendicular denaturing gradient gel in which the denaturing gradient is perpendicular to the electrophoresis direction. B, Parallel denaturing gradient gel in which gradient is parallel to the electrophoresis direction. lane 1, mutant fragment; lane 2, wild-type fragment; lane 3, mutant and wild-type fragments. (lower)


4490540

방법

Isolation of DNA

  • PCR-DGGE analysis

  • Primer set (gc338f/518r)

  • PCR condition (“touchdown” PCR)

  • 8% (wt/vol) polyacrylamide gels in 1X TAE

  • denaturing gradient ranging from 10% to 50% urea-formamide denaturing gradient (with 100% defined as 7 M urea and 40% [vol/vol] formamide)

  • gel electrophoresis : 16 h at 60 V

  • Staining : SYBR Green I (Sigma Co., St. Louis, MS) for 30 min

Sequencing of DGGE fragments

Analysis of the sequence data


4490540

16S rRNA-targeted PCR primers used in this study.

Primer

338f

518r

Sequence (5’-3’)

ACT CCT ACG GGA GGC AGC AG

ATT ACC GCG GCT GCT GG

Position

357-338

534-518

Reference

Lane, D. J. (1991)

Muyzer, A. E. et al. (1993)

A GC clamp was attached to the 5’ end of primer 338f to obtain primer gc338f (GC clamp, 5’CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGCACGGGGGG). Muyzer, A. E. et al. (1993)


4490540

PCR product obtained from amplification of chromosomal DNA with gc338f/518r primer set

200bp


4490540

A

4

5

6

8

1

11

14

17

20

26

30

days

0

Weissella confusa group

Leuconostoc citreum

Lactobacillus sakei

Lactobacillus curbatus

Leuconostoc gelidium

B

days

1

2

3

5

6

8

10

14

18

20

0

Weissella confusa group

Leuconostoc citreum

Leuconostoc gelidium

Lactobacillus sakei

Lactobacillus curbatus

Lactococcus lactis subsp. lactis

DGGE analysis of PCR-amplified 16S rDNA fragments of microbial communities from kimchi fermented at 10C (A) and 20C (B).


4490540

DGGE profiles from LAB reference strains and kimchi samples.

2

5

10

11

12

13

14

15

16

3

4

6

7

8

9

1

a

b

c

d

e

f

g

Lanes: 1, Weissella confusa KCTC 3499T; 2, kimchi sample for 26 days at 10C; 3, kimchi sample for 18 days at 20C; 4, Leuconostoc citreum KCTC 3526T; 5, Leuconostoc gasicomotatum KCTC 3752T; 6, Leuconostoc gelidium KCTC 3527T; 7, Leuconostoc pseudomesenteroides KCTC 3652T; 8, Leuconostoc mesenteroides subsp. mesenteroides KCTC 3505T; 9, Leuconostoc mesenteroides subsp. dextranicum KCTC 3530T; 10, Leuconostoc mesenteroides subsp. cremoris KCTC 3529T; 11, Lactobacillus brevis KCTC 3498T; 12, Lactobacillus curvatus KCTC 3767T; 13, Lactobacillus sakei KCTC 3603T; 14, Lactobacillus plantarum KCTC 3108T; 15, Lactobacillus fermentum KCTC 3112T; 16, Lactococcus lactis subsp. lactis KCTC 3769T.


4490540

Conclusion

  • main microorganisms for kimchi fermentation in DGGE analysis

    • Weissella confusa group (Weissella cibaria, Weissella confusa and Weissella kimchii), Leuconostoc citreum, Lactobacillus curvatus, and Lactobacillus sakei

  • We demonstrated that the ecology of kimchi cannot be effectively studied by cultivation-dependent methods alone, because some of dominating taxa, although culturable, are not recovered by this traditional approach.

  • A polyphasic approach should allow us to better understand the dynamic changes during kimchi fermentation.


  • Login