V3 multiples sequenz alignment und phylogenie
Download
1 / 83

V3 - Multiples Sequenz Alignment und Phylogenie - PowerPoint PPT Presentation


  • 57 Views
  • Uploaded on

Literatur: Kapitel 4 in Buch von David Mount Thioredoxin-Beispiel heute aus Buch von Arthur Lesk. V3 - Multiples Sequenz Alignment und Phylogenie. Definition von “Homologie”. Homologie : Ähnlichkeit , die durch Abstammung von einem gemeinsamen Ursprungsgen herrührt –

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' V3 - Multiples Sequenz Alignment und Phylogenie' - valin


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
V3 multiples sequenz alignment und phylogenie

Literatur: Kapitel 4 in Buch von David Mount

Thioredoxin-Beispiel heute aus Buch von Arthur Lesk

V3 - Multiples Sequenz Alignment und Phylogenie

Softwarewerkzeuge der Bioinformatik


Definition von “Homologie”

  • Homologie: Ähnlichkeit, die durch

    Abstammung von einem gemeinsamen

    Ursprungsgen herrührt –

    die Identifizierung und Analyse von

    Homologien ist eine zentrale Aufgabe

    der Phylogenie.

  • Ein Alignment ist eine Hypothese

    für die positionelle Homologie

    zwischen Basenpaaren bzw.

    Aminosäuren.

Softwarewerkzeuge der Bioinformatik

http://www.cellsignal.com


Alignments können einfach oder schwer sein

GCGGCCCA TCAGGTACTT GGTGG

GCGGCCCA TCAGGTAGTT GGTGG

GCGTTCCA TCAGCTGGTT GGTGG

GCGTCCCA TCAGCTAGTT GGTGG

GCGGCGCA TTAGCTAGTT GGTGA

******** ********** *****

TTGACATG CCGGGG---A AACCG

TTGACATG CCGGTG--GT AAGCC

TTGACATG -CTAGG---A ACGCG

TTGACATG -CTAGGGAAC ACGCG

TTGACATC -CTCTG---A ACGCG

******** ?????????? *****

Einfach

Schwierig wegen Insertionen und

Deletionen (indels)

Kann man beweisen, dass ein Alignment korrekt ist?

Softwarewerkzeuge der Bioinformatik


Protein-Alignment kann durch tertiäre Strukturinformationen geführt werden

Gaps eines

Alignments

sollten

vorwiegend

in Loops

liegen, nicht

in Sekundär-

struktur-

elementen.

Escherichia coli DjlA protein

Homo sapiens DjlA protein

nur so kann man letztlich bewerten, ob ein Sequenzalignment korrekt ist.

Beweisen im strikten Sinne kann man dies nie.

Softwarewerkzeuge der Bioinformatik


Farbe Aminosäuretyp Aminosäuren

gelb klein, wenig polar Gly, Ala, Ser, Thr

grün hydrophob Cys, Val, Ile, Leu

Pro, Phe, Tyr, Met, Trp

violett polar Asn, Gln, His

rot negativ geladen Asp, Glu

blau positiv geladen Lys, Arg

MSA für Thioredoxin-Familie

Softwarewerkzeuge der Bioinformatik


Infos aus MSA von Thioredoxin-Familie

Thioredoxin: aus 5 beta-Strängen bestehendes beta-Faltblatt,

das auf beiden Seiten von alpha-Helices flankiert ist.

gemeinsamer Mechanismus: Reduktion von Disulfidbrücken in Proteinen

Softwarewerkzeuge der Bioinformatik


Infos aus MSA von Thioredoxin-Familie

1) Die am stärksten konservierten Abschnitte entsprechen wahrscheinlich dem aktiven Zentrum. Disulfidbrücke zwischen Cys32 und Cys35 gehört zu dem konservierten WCGPC[K oder R] Motiv. Andere konservierte Sequenzabschnitte, z.B. Pro76Thr77 und Gly92Gly93 sind an der Substratbindung beteiligt.

Softwarewerkzeuge der Bioinformatik


Infos aus MSA von Thioredoxin-Familie

2) Abschnitte mit vielen Insertionen und Deletionen entsprechen vermutlich Schleifen an der Oberfläche. Eine Position mit einem konservierten Gly oder Pro lässt auf eine Wendung der Kette (‚turn‘) schließen.

Softwarewerkzeuge der Bioinformatik


Infos aus MSA von Thioredoxin-Familie

3) Ein konserviertes Muster hydrophober Bausteine mit dem Abstand 2 (d.h., an jeder zweiten Position), bei dem die dazwischenliegenden Bausteine vielfältiger sind und auch hydrophil sein können, läßt auf ein -Faltblatt an der Moleküloberfläche schließen.

Softwarewerkzeuge der Bioinformatik


Infos aus MSA von Thioredoxin-Familie

4) Ein konserviertes Muster hydrophober Aminosäurereste mit dem Abstand von ungefähr 4 läßt auf eine -Helix schließen.

Softwarewerkzeuge der Bioinformatik


Infos aus MSA von Thioredoxin-Familie

Die Thioredoxine sind Teil einer Superfamilie, zu der auch viele weiter entfernte homologe Protein gehören,

z.B. Glutaredoxin (Wasserstoffdonor für die Reduktion von Ribonukleotiden bei der DNA-Synthese)

Protein-Disulfidisomerase (katalysiert bei der Proteinfaltung den Austausch falsch gefalteter Disulfidbrücken)

Phosducin (Regulator in G-Protein-abhängigen Signalübertragungswegen)

Glutathion-S-Transferasen (Proteine der chemischen Abwehr).

Die Tabelle des MSAs für Thioredoxinsequenzen enthält implizit Muster,

die man zur Identifizierung dieser entfernteren Verwandten nutzen kann.

Softwarewerkzeuge der Bioinformatik


Multiples Sequenz-Alignment- Methoden

Es gibt im wesentlichen 3 unterschiedliche Vorgehensweisen:

(1) Manuell

ein manuelles Alignment bietet sich an falls

  • Alignment einfach ist.

  • es zusätzliche (strukturelle) Information gibt

  • automatische Alignment –Methoden in lokalen Minima feststecken.

  • ein automatisch erzeugtes Alignment manuell “verbessert” werden kann.

    (2) Automatisch

    (3) Kombiniert

Softwarewerkzeuge der Bioinformatik


Automatisches multiples Sequenzalignment

Hier gibt es vor allem folgende 2 wichtigen Methoden:

  • DynamischeProgrammierung

    • liefert garantiert das optimale Alignment!

    • aber: betrache 2 Proteinsequenzen von 100 Aminosäuren Länge.

      wenn es 1002Sekunden dauert, diese beiden Sequenzen erschöpfend zu alignieren, dann wird es

      1003Sekunden dauern um 3 Sequenzen zu alignieren,

      1004Sekunden für 4 Sequenzen und

      1.90258x1034Jahre für 20 Sequenzen.

  • Progressives Alignment

Softwarewerkzeuge der Bioinformatik


dynamische Programmierung mit MSA Programm

berechne zunächst paarweise Alignments

für 3 Sequenzen wird Würfel aufgespannt:

D.h. dynamische Programmierung hat nun Komplexität n1 * n2 * n3

mit den Sequenzlängen n1, n2, n3.

Sehr aufwändig! Versuche, Suchraum einzuschränken und nur einen kleinen

Teil des Würfels abzusuchen.

Softwarewerkzeuge der Bioinformatik


Progressives Alignment

  • wurde von Feng & Doolittle 1987 vorgestellt

  • ist eine heuristische Methode.

    Daher ist nicht garantiert, das “optimale” Alignment zu finden.

  • benötigt(n-1) + (n-2) + (n-3) ... (n-n+1)paarweise Sequenzalignments als Ausgangspunkt.

  • weitverbreitete Implementation in Clustal(Des Higgins)

  • ClustalW ist eine neuere Version, in der den Parameter für Sequenzen und Programm Gewichte (weights) zugeteilt werden.

Softwarewerkzeuge der Bioinformatik


ClustalW- Paarweise Alignments

  • Berechne alle möglichen paarweisen Alignments von Sequenzpaaren.

    Es gibt (n-1)+(n-2)...(n-n+1) Möglichkeiten.

  • Berechne aus diesen isolierten paarweisen Alignments den “Abstand” zwischen jedem Sequenzpaar.

  • Erstelle eine Abstandsmatrix.

  • aus den paarweisen Distanzen wird ein Nachbarschafts-Baum erstellt

  • Dieser Baum gibt die Reihenfolge an, in der das progressive Alignment ausgeführt werden wird.

Softwarewerkzeuge der Bioinformatik


Berblick der clustalw pro z edur
Überblick der ClustalW Prozedur

Hbb_Human 1 -

CLUSTAL W

Hbb_Horse 2 .17 -

Hba_Human 3 .59 .60 -

Hba_Horse 4 .59 .59 .13 -

Schnelle paarweise Alignments:

berechne Matrix der Abstände

Myg_Whale 5 .77 .77 .75 .75 -

Hbb_Human

4

2

3

Hbb_Horse

Hba_Human

1

Nachbar-Verbindungs-

Baumdiagramm

Hba_Horse

Myg_Whale

alpha-helices

1 PEEKSAVTALWGKVN--VDEVGG

2

3

4

2 GEEKAAVLALWDKVN--EEEVGG

progressive Alignments

entsprechend dem

Baumdiagramm

3 PADKTNVKAAWGKVGAHAGEYGA

1

4 AADKTNVKAAWSKVGGHAGEYGA

5 EHEWQLVLHVWAKVEADVAGHGQ

Softwarewerkzeuge der Bioinformatik


Multiples Alignment- Erstes Paar

  • aligniere die beiden ähnlichsten Sequenzen zuerst.

  • dieses Alignment ist dann “fest” und wird nicht mehr angetastet.

    Falls später ein GAP eingeführt werden muss, wird er in beiden Sequenzen an der gleichen Stelle eingeführt.

  • Deren relatives Alignment bleibt unverändert.

Softwarewerkzeuge der Bioinformatik


Clustal W – Zeit der Entscheidung

Ziehe den Baum heran um festzulegen, welches Alignment als nächstes durchgeführt werden soll:

  • aligniere eine dritte Sequenz zu den ersten beiden

    oder

  • aligniere zwei total verschiedene Sequenzen miteinander.

Option 1

Option 2

Softwarewerkzeuge der Bioinformatik


ClustalW- 2 Alternativen

Wenn beim Alignment einer dritten Sequenz mit den ersten beiden eine Lücke eingefügt werden muss um das Alignment zu verbessern, werden beide als Einzelsequenzen betrachtet.

Falls, andererseits, zwei getrennte Sequenzen aligniertwerden müssen, werden diese zunächst miteinander aligniert.

+

+

Softwarewerkzeuge der Bioinformatik


Progressives Alignment – 1. Schritt

gctcgatacgatacgatgactagcta

gctcgatacaagacgatgacagcta

gctcgatacacgatgactagcta

gctcgatacacgatgacgagcga

ctcgaacgatacgatgactagct

gctcgatacgatacgatgactagcta

gctcgatacaagacgatgac-agcta

Softwarewerkzeuge der Bioinformatik


Progressives Alignment – 2. Schritt

gctcgatacgatacgatgactagcta

gctcgatacaagacgatgacagcta

gctcgatacacgatgactagcta

gctcgatacacgatgacgagcga

ctcgaacgatacgatgactagct

gctcgatacacgatgactagcta

gctcgatacacgatgacgagcga

Softwarewerkzeuge der Bioinformatik


Progressives Alignment – 3. Schritt

gctcgatacgatacgatgactagcta

gctcgatacaagacgatgac-agcta

+

gctcgatacacgatgactagcta

gctcgatacacgatgacgagcga

gctcgatacgatacgatgactagcta

gctcgatacaagacgatgac-agcta

gctcgatacacga---tgactagcta

gctcgatacacga---tgacgagcga

Softwarewerkzeuge der Bioinformatik


Progressives Alignment – letzter Schritt

gctcgatacgatacgatgactagcta

gctcgatacaagacgatgac-agcta

gctcgatacacga---tgactagcta

gctcgatacacga---tgacgagcga

+

ctcgaacgatacgatgactagct

gctcgatacgatacgatgactagcta

gctcgatacaagacgatgac-agcta

gctcgatacacga---tgactagcta

gctcgatacacga---tgacgagcga

-ctcga-acgatacgatgactagct-

Softwarewerkzeuge der Bioinformatik


ClustalW- Vor- und Nachteile

Vorteil:

  • Geschwindigkeit.

    Nachteile:

  • keine objektive Funktion.

  • Keine Möglichkeit zu quantifizieren ob Alignment gut oder schlecht ist

    (vgl. E-value für BLAST)

  • Keine Möglichkeit festzustellen, ob das Alignment “korrekt” ist

    Mögliche Probleme:

  • Prozedur kann in ein lokales Minimum geraten.

    D.h. falls zu einem frühen Zeitpunkt ein Fehler im Alignment eingebaut wird, kann dieser später nicht mehr korrigiert werden.

  • ZufälligesAlignment.

Softwarewerkzeuge der Bioinformatik


Genauigkeit des Alignments verbessern

  • Sollen all Sequenzen gleich behandelt werden?

    Obwohl manche Sequenzen eng verwandt und andere entfernt verwandt sind?

  • Sollen alle Positionen der Sequenzen gleich behandelt werden?

    Obwohl sie unterschiedliche Funktionen und Positionen in der dreidimensionalen Strukturen haben können?

Softwarewerkzeuge der Bioinformatik


ClustalW- Besonderheiten

  • Sequenzgewichtung

  • Variable Substitutionsmatrizen

  • Residuen-spezifische Gap-Penalties und verringerte Penalties in hydrophilen Regionen (externe Regionen von Proteinsequenzen), bevorzugt Gaps in Loops anstatt im Proteinkern.

  • Positionen in frühen Alignments, an denen Gaps geöffnet wurden, erhalten lokal reduzierte Gap Penalties um in späteren Alignments Gaps an den gleichen Stellen zu bevorzugen

Softwarewerkzeuge der Bioinformatik


ClustalW- vom Benutzer festzulegende Parameter

  • Zwei Parameter sind festzulegen (es gibt Default-Werte, aber man sollte sich bewusst sein, dass diese abgeändert werden können):

  • Die GOP- Gap Opening Penaltyist aufzubringen um eine Lücke in einem Alignment zu erzeugen

  • Die GEP- Gap Extension Penaltyist aufzubringen um diese Lücke um eine Position zu verlängern.

Softwarewerkzeuge der Bioinformatik


Positions-spezifische Gap penalties

  • Bevor irgendein Sequenzpaar aligniert wird, wird eine Tabelle von GOPs erstellt für jede Position der beiden Sequenzen.

  • Die GOP werden positions-spezifisch behandelt und können über die Sequenzlänge variieren.

  • Falls ein GAP an einer Position existiert, werden die GOP und GEP penalties herabgesetzt – und alle anderen Regeln treffen nicht zu.

  • Daher wird die Bildung von Gaps an Positionen wahrscheinlicher, an denen bereits Gaps existieren.

Softwarewerkzeuge der Bioinformatik


Vermeide zu viele Gaps

  • Solange kein GAP offen ist, wird GOP hochgesetzt falls die Position innerhalb von 8 Residuen von einem bestehenden Gap liegt.

  • Dadurch werden Gaps vermieden, die zu eng beieinander liegen.

  • An jeder Position innerhalb einer Reihe von hydrophilen Residuen wird GOP herabgesetzt, da diese gewöhnlich in Loop-Regionen von Proteinstrukturen liegen.

  • Eine Reihe von 5 hydrophilen Residuen gilt als hydrophiler stretch.

  • Die üblichen hydrophilen Residuen sind:

    D Asp K Lys P Pro

    E Glu N Asn R Arg

    G Gly Q Gln S Ser

    Dies kann durch den Benutzer geändert werden.

Softwarewerkzeuge der Bioinformatik


Tips für progressives Alignment

  • Progressives Alignment ist ein mathematischer Vorgang, der völlig unabhängig von der biologischen Realität abläuft.

  • Es kann eine sehr gute Abschätzung sein.

  • Es kann eine unglaublich schlechte Abschätzung sein.

  • Erfordert Input und Erfahrung des Benutzers.

  • Sollte mit Vorsicht verwendet werden.

  • Kann (gewöhnlich) manuell verbessert werden.

  • Es hilft oft, farbliche Darstellungen zu wählen.

  • Je nach Einsatzgebiet sollte der Benutzer in der Lage sein, die zuverlässigen Regionen des Alignments zu beurteilen.

  • Für phylogenetische Rekonstruktionen sollte man nur die Positionen verwenden, für die eine zweifelsfreie Hypothese über positionelle Homologie vorliegt.

Softwarewerkzeuge der Bioinformatik


Alignment von Protein-kodierenden DNS-Sequenzen

  • Es macht wenig Sinn, proteinkodierende DNS-Abschnitte zu alignieren!

ATGCTGTTAGGG

ATGCTCGTAGGG

ATGCT-GTTAGGG

ATGCTCGT-AGGG

Das Ergebnis kann sehr unplausibel sein und entspricht eventuell nicht dem biologischen Prozess.

Es ist viel sinnvoller, die Sequenzen in die entsprechenden Proteinsequenzen zu übersetzen, diese zu alignieren und dann in den DNS-Sequenzen an den Stellen Gaps einzufügen, an denen sie im Aminosäure-Alignment zu finden sind.

Softwarewerkzeuge der Bioinformatik


Zusammenfassung

Progressive Alignments sind die am weitesten verbreitete Methode für multiple Sequenzalignments.

Sehr sensitive Methode ebenfalls: Hidden Markov Modelle (HMMer)

Multiples Sequenzalignment ist nicht trivial. Manuelle Nacharbeit kann in Einzelfällen das Alignment verbessern.

Multiples Sequenzalignment erlaubt Denken in Proteinfamilien und –funktionen.

Softwarewerkzeuge der Bioinformatik


Prediction of phylogenies based on single genes
Prediction of Phylogenies based on single genes

Material of this lecture taken from

- chapter 6, DW Mount „Bioinformatics“

and from Julian Felsenstein‘s book.

A phylogenetic analysis of a family of related

nucleic acid or protein sequences is a determination

of how the family might have been derived during evolution.

Placing the sequences as outer branches on a tree, the evolutionary relationships among the sequences are depicted.

Phylogenies, or evolutionary trees, are the basic structures to describe differences between species, and to analyze them statistically.

They have been around for over 140 years.

Statistical, computational, and algorithmic work on them is ca. 40 years old.

Softwarewerkzeuge der Bioinformatik


3 main approaches in single gene phylogeny
3 main approaches in single-gene phylogeny

- maximum parsimony

- distance matrix

- maximum likelihood (not covered here)

Popular programs:

PHYLIP (phylogenetic inference package – J Felsenstein)

PAUP (phylogenetic analysis using parsimony – Sinauer Assoc

Softwarewerkzeuge der Bioinformatik


Parsimony methods
Parsimony methods

Edwards & Cavalli-Sforza (1963): that evolutionary tree is to be preferred that involves „the minimum net amount of evolution“.

 seek that phylogeny on which, when we reconstruct the evolutionary events leading to our data, there are as few events as possible.

(1) We must be able to make a reconstruction of events, involving as few events as possible, for any proposed phylogeny.

(2) We must be able to search among all possible phylogenies for the one or ones that minimize the number of events.

Softwarewerkzeuge der Bioinformatik


A simple example
A simple example

Suppose that we have 5 species,

each of which has been scored for 6 characters (0,1)

We will allow changes 0  1 and 1  0.

The initial state at the root of a tree may be either state 0 or state 1.

Softwarewerkzeuge der Bioinformatik


Evaluating a particular tree
Evaluating a particular tree

To find the most parsimonious tree, we must have a way of calculating how many changes of state are needed on a given tree.

This tree represents the phylogeny of character 1.

Reconstruct phylogeny of character 1 on this tree.

Softwarewerkzeuge der Bioinformatik


Evaluating a particular tree1
Evaluating a particular tree

There are 2 equally good reconstructions,

each involving just one change of character state.

They differ in which state they assume at the root of the tree,

and they differ in which branch they place the single change.

Softwarewerkzeuge der Bioinformatik


Evaluating a particular tree2
Evaluating a particular tree

3 equally good reconstructions for character 2, which needs two changes of state.

Softwarewerkzeuge der Bioinformatik


Evaluating a particular tree3
Evaluating a particular tree

A single reconstruction for character 3, involving one change of state.

Softwarewerkzeuge der Bioinformatik


Evaluating a particular tree4
Evaluating a particular tree

on the right: 2 reconstructions for character 4 and 5 because these characters have identical patterns.

single reconstruction for character 6,

one change of state.

Softwarewerkzeuge der Bioinformatik


Evaluating a particular tree5
Evaluating a particular tree

The total number of changes of character state needed on this tree is

1 + 2 + 1 + 2 + 2 + 1 = 9

Reconstruction of the changes in state on this tree

Softwarewerkzeuge der Bioinformatik


Evaluating a particular tree6
Evaluating a particular tree

Alternative tree with only 8 changes of state.

The minimum number of changes of state would be 6, as there are 6 characters that can each have 2 states.

Thus, we have two „extra“ changes  called „homoplasmy“.

Softwarewerkzeuge der Bioinformatik


Finding the best tree by heuristic search
Finding the best tree by heuristic search

The obvious method for searching for the most parsimonious tree is to consider ALL trees and evaluate each one.

Unfortunately, generally the number of possible trees is too large.

 use heuristic search methods that attempt to find the best trees without looking at all possible trees.

(1) Make an initial estimate of the tree and make small rearrangements of it

= find „neighboring“ trees.

(2) If any of these neighbors are better, consider them and continue search.

Softwarewerkzeuge der Bioinformatik


Counting evolutionary changes
Counting evolutionary changes

2 related dynamic programming algorithms: Fitch (1971) and Sankoff (1975)

- evaluate a phylogeny character by character

- for each character, consider it as rooted tree, placing the root wherever seems appropriate.

- update some information down a tree; when we reach the bottom, the number of changes of state is available.

Do not actually locate changes or reconstruct interior states at the nodes of the tree.

Softwarewerkzeuge der Bioinformatik


Sankoff algorithm
Sankoff algorithm

If we can compute these values for all nodes,

we can also compute them for the bottom node in the tree.

Simply choose the minimum of these values

which is the desired total cost we seek, the minimum cost of evolution for this character.

At the tips of the tree, the S(i) are easy to compute. The cost is 0 if the observed state is state i, and infinite otherwise.

If we have observed an ambigous state, the cost is 0 for all states that it could be, and infinite for the rest.

Now we just need an algorithm to calculate the S(i) for the immediate common ancestor of two nodes.

Softwarewerkzeuge der Bioinformatik


Sankoff algorithm1
Sankoff algorithm

Suppose that the two descendant nodes are called l and r (for „left“ and „right“).

For their immediate common ancestor, node a, we compute

The smallest possible cost given that node a is in state i is the cost cijof going from state i to state j in the left descendant lineage, plus the cost Sl(j) of events further up in the subtree gien that node l is in state j. Select value of j that minimizes that sum.

Same calculation for right descendant lineage  sum of these two minima is the smallest possible cost for the subtree above node a, given that node a is in state i.

Apply equation successively to each node in the tree, working downwards.

Finally compute all S0(i) and use previous eq. to find minimum cost for whole tree.

Softwarewerkzeuge der Bioinformatik


Sankoff algorithm2
Sankoff algorithm

The array (6,6,7,8) at the bottom of the tree has a minimum value of 6

= minimum total cost of the tree for this site.

Softwarewerkzeuge der Bioinformatik


Distance matrix methods
Distance matrix methods

introduced by Cavalli-Sforza & Edwards (1967)

and by Fitch & Margoliash (1967)

general idea „seems as if it would not work very well“ (Felsenstein):

- calculate a measure of the distance between each pair of species

- find a tree that predicts the observed set of distances as closely as possible.

All information from higher-order combinations of character states is left out.

But computer simulation studies show that the amount of lost information is remarkably small.

Best way to think about distance matrix methods:

consider distances as estimates of the branch length separating that pair of species.

Softwarewerkzeuge der Bioinformatik


Least square method
Least square method

- observed table (matrix) of distances Dij

- any particular tree leads to a predicted set of distances dij.

Softwarewerkzeuge der Bioinformatik


Least square method1
Least square method

Measure of the discrepancy between the observed and expected distances:

where the weights wij can be differently defined:

- wij= 1 (Cavalli&Sforza, 1967)

- wij= 1/Dij2 (Fitch&Margoliash, 1967)

- wij= 1/Dij (Beyer et al., 1974)

Aim: Find tree topology and branch lengths that minimize Q.

Equation above is quadratic in branch lengths.

Take derivative with respect to branch lengths, set = 0,

and solve system of linear equations. Solution will minimize Q.

Doug Brutlag‘s course

Softwarewerkzeuge der Bioinformatik


Least square method2
Least square method

Number all branches of the tree and introduce an indicator variable xijk:

xijk = 1 if branch k lies in the path from species i to species j

xijk = 0 otherwise.

The expected distance between i and j will then be

and

For the case with wij = 1 ij.

Note: these are k equations for each of the k branches.

Softwarewerkzeuge der Bioinformatik


Neighbor joining method
neighbor-joining method

introduced by Saitou and Nei (1987) – algorithm works by clustering - does not assume a molecular clock but approximates the „minimum evolution“ model.

„Minimum evolution“ model:

among possible tree topologies, choose the one with minimal total branch length.

Neighbor-joining, as the least-squares method, is guaranteed to recover the true tree if the distance matrix is an exact reflection of the tree.

Softwarewerkzeuge der Bioinformatik


Neighbor joining method1
neighbor-joining method

(1) For each tip, compute

(2) Choose the i and j for which Dij – ui – uj is smallest.

(3) Join items i and j. Compute the branch length

from i to the new node (vi) and from j to the new

node (vj) as

(4) Compute distance between the new node (ij) and each of the remaining tips as

(5) Delete tips i and j from the tables and replace them by the new node, (ij), which is now treated as a tip.

(6) If more than 2 nodes remain, go back to step (1). Otherwise, connect the two remaining nodes (e.g. l and m) by a branch of length Dlm.

Softwarewerkzeuge der Bioinformatik


Methoden f r einzel gen phylogenien
Methoden für Einzel-Gen-Phylogenien

Wähle Menge von

verwandten

Sequenzen

Berechne

multiples

Sequenz-

alignment

Gibt es starke

Sequenz-

ähnlichkeit?

Ja

Maximale

Parsimonie

Methoden

Nein

Ja

Gibt es deutlich erkenn-bare Sequenzähnlichkeit?

Distanz-

methoden

Nein

Analysiere wie gut die Daten die

Vorhersage

unterstützen

Maximum likelihood

Methoden

Softwarewerkzeuge der Bioinformatik


zusätzliche Folien

Softwarewerkzeuge der Bioinformatik


Software für manuelle Alignments

GDE- The Genetic Data Environment (UNIX)

CINEMA- Java applet available from:

  • http://www.biochem.ucl.ac.uk

    Seqapp/Seqpup- Mac/PC/UNIX available from:

  • http://iubio.bio.indiana.edu

    SeAl for Macintosh, available from:

  • http://evolve.zoo.ox.ac.uk/Se-Al/Se-Al.html

    BioEdit for PC, available from:

  • http://www.mbio.ncsu.edu/RNaseP/info/programs/BIOEDIT/bioedit.html

Softwarewerkzeuge der Bioinformatik


Beispiel: Src-Kinase HcK

Sequenz:

MGGRSSCEDP GCPRDEERAP RMGCMKSKFL QVGGNTFSKT ETSASPHCPV

YVPDPTSTIK PGPNSHNSNT PGIREAGSED IIVVALYDYE AIHHEDLSFQ

KGDQMVVLEE SGEWWKARSL ATRKEGYIPS NYVARVDSLE TEEWFFKGIS

RKDAERQLLA PGNMLGSFMI RDSETTKGSY SLSVRDYDPR QGDTVKHYKI

RTLDNGGFYI SPRSTFSTLQ ELVDHYKKGN DGLCQKLSVP CMSSKPQKPW

EKDAWEIPRE SLKLEKKLGA GQFGEVWMAT YNKHTKVAVK TMKPGSMSVE

AFLAEANVMK TLQHDKLVKL HAVVTKEPIY IITEFMAKGS LLDFLKSDEG

SKQPLPKLID FSAQIAEGMA FIEQRNYIHR DLRAANILVS ASLVCKIADF

GLARVIEDNE YTAREGAKFP IKWTAPEAIN FGSFTIKSDV WSFGILLMEI

VTYGRIPYPG MSNPEVIRAL ERGYRMPRPE NCPEELYNIM MRCWKNRPEE

RPTFEYIQSV LDDFYTATES QYQQQP

SMART ergibt:

Softwarewerkzeuge der Bioinformatik


Beispiel: Src-Kinase HcK

Kinase-Einheit

Protein Data Bank

http://www.rcsb.org

1ATP

Softwarewerkzeuge der Bioinformatik


Beispiel: Src-Kinase HcK

SH3 Domäne

Src homology 3 (SH3) Domänen binden an Zielproteine mit Sequenzen, die Proline und hydrophobe Aminosäuren enthalten. Pro-enthaltende Polypeptide können an SH3 in zwei verschiedenen Orientierungen binden. SH3 Domänen sind kleine Proteinmodule von ungefähr 50 Residuen Länge. Man findet sie in vielen intrazellulären oder Membran-assoziierten Proteinen …

CATH: 1abo

Softwarewerkzeuge der Bioinformatik


Beispiel: Src-Kinase HcK

SH2 Domäne

Die Src homology 2 (SH2) Domäne ist eine Proteindomäne mit etwa 100 Aminosäuren. SH2 Domänen funktionieren als Regelmodule von intrazellulären Signalkaskaden indem sie mit grosser Affinität an Phospho-Tyrosin enthaltende Peptide binden. SH2 Domänen findet man oft zusammen mit SH3 Domänen … Ihre Struktur ist alpha+beta …

CATH: 1g83 1fbz 1aot

Softwarewerkzeuge der Bioinformatik


Beispiel: Src-Kinase HcK

http://jkweb.berkeley.edu/

Softwarewerkzeuge der Bioinformatik


Was kann man mit modularem Denken erreichen?

http://www.cellsignal.com

Softwarewerkzeuge der Bioinformatik


Least square method3
Least square method

DAB + DAC + DAD + DAE = 4v1 + v2 + v3 + v4 + v5 + 2v6 + 2v7

DAB + DBC + DBD + DBE = v1 + 4v2 + v3 + v4 + v5 + 2v6 + 3v7

DAC + DBC + DCD + DCE = v1 + v2 + 4v3 + v4 + v5 + 3v6 + 2v7

DAD + DBD + DCD + DDE = v1 + v2 + v3 + 4v4 + v5 + 2v6 + 3v7

DAE + DBE + DCE + DDE = v1 + v2 + v3 + v4 + 4v5 + 3v6 + 2v7

DAC + DAE + DBC + DBE + DCD + DDE = 2v1 + 2v2 + 3v3 + 2v4 + 3v5 + 6v6 + 4v7

DAB + DAD + DBC + DCD + DBE + DDE = 2v1 + 3v2 + 2v3 + 3v4 + 2v5 + 4v6 + 6v7

Stack up the (4 + 3 + 2 + 1 = 10) Dij, in alphabetical order, into a vector

and the coefficients xijk

are arranged in a matrix X

with each row corresponding

to the Dij in the row of d and

containing a 1 if branch k

occurs on the path between

species i and j.

Softwarewerkzeuge der Bioinformatik


Least square method4
Least square method

If we also stack up the 7 vi into a vector v, the previous set of linear equations can be compactly expressed as:

Multiplied from the left by the inverse of XTX one can solve for the least squares branch lengths

This is a standard method of expressing least squares problems in matrix notation and solving them.

check for example :-)

Softwarewerkzeuge der Bioinformatik


Least square method5
Least square method

When we have weighted least squares, with a diagonal matrix of weights in the same order as the Dij:

then the least square equations can be written

and their solution

Softwarewerkzeuge der Bioinformatik


Finding the least squares tree topology
Finding the least squares tree topology

Now that we are able to assign branch lengths to each tree topology.

we need to search among tree topologies.

This can be done by the same methods of heuristic search that were presented for the Maximum Parsimony method.

Note: no-one has sofar presented a branch-and-bound method for finding the least squares tree exactly. Day (1986) has shown that this problem is NP-complete.

The search is not only among tree topologies, but also among branch lengths.

Softwarewerkzeuge der Bioinformatik


Methods of rooting the tree
Methods of rooting the tree

There are many rooted trees, one for each branch of this unrooted tree,

and all have the same number of changes of state.

The number of changes of state only depends on the unrooted tree, and not at all on where the tree is then rooted.

Biologists want to think of trees as rooted

 need method to place the root in an otherwise unrooted tree.

(1) Outgroup criterion

(2) Use a molecular clock.

Softwarewerkzeuge der Bioinformatik


Outgroup criterion
Outgroup criterion

Assumes that we know the answer in advance.

Suppose that we have a number of great apes,

plus a single old-world monkey.

Suppose that we know that the great apes are a monophyletic group.

If we infer a tree of these species, we know that the root must be placed on the lineage that connects the old-world monkey (outgroup) to the great apes (ingroup).

Softwarewerkzeuge der Bioinformatik


Molecular clock
Molecular clock

If an equal amount of changes were observed on all lineages, there should be a point on the tree that has equal amounts of change (branch lengths) from there to

all tips.

With a molecular clock, it is only the expected amounts of change that are equal.

The observed amounts may not be.

 using various methods find a root that makes the amounts of change approximately equal on all lineages.

Softwarewerkzeuge der Bioinformatik


Branch lengths
Branch lengths

Having found an unrooted tree, locate the changes on it and find out how many occur in each of the branches.

The location of the changes can be ambiguous.

 average over all possible reconstructions of each character for which there is ambiguity in the unrooted tree.

Fractional numbers in some branches of left tree

add up to (integer) number of changes (right)

Softwarewerkzeuge der Bioinformatik


Open questions
Open questions

* Particularly for larger data sets, need to know how to count number of changes

of state by use of an algorithm.

* need to know algorithm for reconstructing states at interior nodes of the tree.

* need to know how to search among all possible trees for the most parsimonious ones, and how to infer branch lengths.

* sofar only considered simple model of 0/1 characters.

DNA sequences have 4 states, protein sequences 20 states.

* Justification: is it reasonable to use the parsimony criterion?

If so, what does it implicitly assume about the biology?

* What is the statistical status of finding the most parsimonious tree?

Can we make statements how well-supported it is compared to other trees?

Softwarewerkzeuge der Bioinformatik


dynamische Programmierung mit MSA Programm

Links: Baum für 5 Sequenzen ohne Paarung von Sequenzen.

Neighbour-joining Methode: berechne Summe aller Kantenlängen

S = a + b + c + d + e (Kantenlängen sind bekannt)

In diesem Fall seien sich A und B am nächsten. Konstruiere daher den Baum rechts.

Generell: Verbinde die Sequenzpaare mit den kürzesten Abständen …

 Man erhält den Baum mit der kleinsten Summe der Kantenlängen.

Konstruiere anhand phylogenetischem Baum ein versuchsweises Multiples Sequenz Alignment.

Softwarewerkzeuge der Bioinformatik


dynamische Programmierung mit MSA Programm

Dieses Alignment dient dazu, den möglichen Raum inmitten des Würfels einzugrenzen, in dem das beste MSA zu finden sein sollte.

Grosse Rechenersparnis!

Softwarewerkzeuge der Bioinformatik


Limitation of distance methods
limitation of distance methods

Distance matrix methods are the easiest phylogeny method to program,

and they are very fast.

Distance methods have problems when the evolutionary rates vary largely.

One can correct for this in distance methods as well as in likelihood methods.

When variation of rates is large, these corrections become important.

In likelihood methods, the correction can use information from changes in one part of the tree to inform the correction in others.

Once a particular part of the molecule is seen to change rapidly in the primates, this will affect the interpretation of that part of the molecule among the rodents as well.

But a distance matrix method is inherently incapable of propagating the information in this way. Once one is looking at changes within rodents, it will forget where changes were seen among primates.

Softwarewerkzeuge der Bioinformatik


Evaluating a particular tree7
Evaluating a particular tree

Figure right shows another tree also requiring 8 changes. These two most parsimonious trees are the same tree when the roots of the tree are removed.

Softwarewerkzeuge der Bioinformatik


Divergente Sequenzen

  • Die am meisten divergenten Sequenzen (also am stärksten von allen anderen Sequenzen verschiedenen) sind gewönlich am schwierigsten zu alignieren

  • Es ist manchmal besser, ihr Alignment auf einen späteren Zeitpunkt zu verschieben (nachdem die einfacheren Sequenzen aligniert wurden)

  • Man kann dazu einen Cutoff wählen (der Default liegt bei 40% Identität).

Softwarewerkzeuge der Bioinformatik


Fitch algorithm
Fitch algorithm

intended to count the number of changes in a bifurcating tree with nucleotide sequence data, in which any one of the 4 bases (A, C, G, T) can change to any other.

At the particular site, we have observed the bases C, A, C, A and G in the 5 species. Give them in the order in which they appear in the tree, left to right.

Softwarewerkzeuge der Bioinformatik


Fitch algorithm1
Fitch algorithm

For the left two, at the node that is their immediate common ancestor,

attempt to construct the intersection of the two sets.

But as {C}  {A} =  instead construct

the union {C}  {A} = {AC} and count 1

change of state.

For the rightmost pair of species, assign

common ancestor as {AG},

since {A}  {G} =  and count another

change of state.

.... proceed to bottom

Total number of changes = 3. Algorithm works on arbitrarily large trees.

Softwarewerkzeuge der Bioinformatik


Complexity of fitch algorithm
Complexity of Fitch algorithm

Fitch algorithm can be carried out in a number of operations that is proportional to the number of species (tips) on the tree.

Don‘t we need to multiply this by the number of sites n ?

Any site that is invariant (which has the same base in all species, e.g. AAAAA) can be dropped.

Other sites with a single variant base (e.g. ATAAA) will only require a single change of state on all trees. These too can be dropped.

For sites with the same pattern (e.g. CACAG) that we have already seen, simply use number of changes previously computed.

Pattern following same symmetry (e.g. TCTCA = CACAG) need same number of changes  numerical effort rises slower than linearly with the number of sites.

Softwarewerkzeuge der Bioinformatik


Sankoff algorithm3
Sankoff algorithm

Fitch algorithm is very effective – but we can‘t understand why it works.

Sankoff algorithm: more complex, but its structure is more apparent.

Assume that we have a table of the cost of changes cij between each character state i and each other state j.

Compute the total cost of the most parsimonious combinations of events by computing it for each character.

For a given character, compute for each node k in the tree a quantity Sk(i).

This is interpreted as the minimal cost, given that node k is assigned state i,

of all the events upwards from node k in the tree.

Softwarewerkzeuge der Bioinformatik


Least square method6
Least square method

v2

v1

v5

v6

v7

v4

v3

Number species in alphabetical order.

The expected distance between species A and D d14 = v1 + v7 + v4

The expected distance between species B and E d25 = v5 + v6 + v7 + v2.

Softwarewerkzeuge der Bioinformatik


ad