MicroRNAs and Prostate Cancer
Download
1 / 13

MicroRNAs and Prostate Cancer - PowerPoint PPT Presentation


  • 105 Views
  • Uploaded on

MicroRNAs and Prostate Cancer. By: Carol Tran Dr. Zendra Zehner Dr. Xueping Zhang. MicroRNA Review. http://www.jyi.org/articleimages/392/originals/img2.jpg. Project Goals.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' MicroRNAs and Prostate Cancer' - uta-jarvis


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

MicroRNAs and Prostate Cancer

By: Carol Tran

Dr. Zendra Zehner

Dr. Xueping Zhang


MicroRNA Review

http://www.jyi.org/articleimages/392/originals/img2.jpg


Project Goals

To test if miR23 and/or miR17 have an effect on the growth, tumorigenic, or metastatic properties of prostate cancer cells.




Summer Goal

1.) To monitor the levels of the microRNAs in

M12 compared to the F6 subline.

2.) To change the levels of the microRNA and measure the

differences in the reporter gene activity.

http://www.clontech.com/products/detail.asp?product_id=10606&tabno=2


5’

3’


Process

  • Clone DNA

  • Transform Bacterial Cells to take up Plasmid DNA molecule

  • Mini-Preps and Maxi-Preps

  • Monitor Effect on Reporter Gene Activity- Transfection

  • Assays for Results


miR Sequence

hsa-miR-23a: ATCACATTGCCAGGGATTTCC

5’GATCCGATCACATTGCCAGGGATTTCCTTTTCAAGAGAGGAAATCCCTGGCAATGTGATTTCTTTTTTTCTAGAG

gCTAGTGTAAGGTCCCTAAAGGAAAAGTTCTCTCCTTTAGGGACGTTACACTAAAGAAAAAAAGATCTCTTAA 5’

hsa-miR-23a-AS: GGAAATCCCTGGCAATGTGAT

5’GATCCGGGAAATCCCTGGCAATGTGATTTTTCAAGAGAATCACATTGCCAGGGATTTCCTTCTTTTTTTCTAGAG

gCCCTTTAGGGACCGTTACACTAAAAAGTTCTCTTTAGTGTAACGGTCCCTAAAGGAAGAAAAAAAGATCTCTTAA 5’




Future Ideas

  • Could measure exact amount of miRs in M12 and F6 sublines instead of reporter gene activity.

  • Northern Blot and radioactivity


CONCLUSION

  • Poured plates

  • Mini plasmid preps

  • Maxi plasmid preps

  • Took ODs

  • dual-Luciferase Assay

  • Culture Cells

  • Transfections


ad