Development
This presentation is the property of its rightful owner.
Sponsored Links
1 / 48

Development of proteomics tools to study intranuclear organization Vasily Ogryzko PowerPoint PPT Presentation


  • 120 Views
  • Uploaded on
  • Presentation posted in: General

Development of proteomics tools to study intranuclear organization Vasily Ogryzko Group of “Proteomics & epigenetics ’, UMR 8126 CNRS, Institut Gustave Roussy 15 мая 2014 Программа визитов иностранных учёных в российские научные центры фонда "Династия". Importance of proteomics.

Download Presentation

Development of proteomics tools to study intranuclear organization Vasily Ogryzko

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Development of proteomics tools to study intranuclear organization vasily ogryzko

Development of proteomics tools to study intranuclearorganization

Vasily Ogryzko

Group of “Proteomics & epigenetics’, UMR 8126 CNRS, Institut Gustave Roussy

15 мая 2014

Программа визитов иностранных учёных в российские научные центры фонда "Династия"


Development of proteomics tools to study intranuclear organization vasily ogryzko

Importance of proteomics

One genome

Two proteomes


Development of proteomics tools to study intranuclear organization vasily ogryzko

Proteomics:

High throughput

Study of proteins

Questions:

Amounts

Localization

Modifications

Interactions

Methodology:

2D electrophoresis

Mass spectrometry

Epitope tagging

Proteins:

Structure Levels


Development of proteomics tools to study intranuclear organization vasily ogryzko

Challenges of postgenomic era:

  • Study post-transcriptional steps in gene regulation

    (microRNA, etc)

  • Decipher mechanisms of epigenetic regulation

  • (histone code, other self-perpetuating protein modifications)

    • Predict function of newly discovered genes

    • (protein-protein interaction partners)

    can be addressed by proteomics


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Healthcare - Research - Education

    International Scientific Advisory Board

    Hospital Activities

    Research Division

    Clinical Research Division

    (DRC)

    Research Units

    (IRCIV)


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Technology Transfert Company

    Research Division

    Eric Solary

    Scientific Policy Committee

    Research Coordination and Management Service / Logistics Service

    Clinical Research

    Gilles Vassal

    Platforms

    Jean-Yves Scoazec

    Imaging / flow cytometry

    Animal facility

    Integrated biology

    Translational research

    Tumor collection

    Biotherapies

    Bioinformatics

    Research Units

    Eric Solary

    Steering Committee

    Steering Committee


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Proteomicsplatform at IGR

    Metabolomics

    platform

    Integrated

    Biology

    Functional

    genomics

    platform

    Lipidomics

    platform

    Biological resources

    center

    Bioinformatics

    platform

    Proteomics

    platform


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Proteomicsplatform at IGR

    Personnel:

    Vasily OGRYZKO– DR2, INSERM

    Alain DEROUSSENT– IR, CNRS

    Emilie COCHET– Technicienne, IGR

    Geographic location:

    IGR, PR2, room 355


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Proteomicsplatform at IGR

    Main instrument:

    Nano-HPLC/CHIP/ion-trap (Agilent)

    +

    Agilent off-gel separator for preanalytic fractionation

    +

    Small laboratory equipment


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    1. Protein footprinting: motivation

    Epigenetic information can be encoded in macromolecular interactions

    Proteins are much more interesting objects than DNA or RNA, i.e. not only their amounts but their conformation and interaction plays essential role


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Protein footprinting: motivation

    Biological system as:

    Chemical reactor

    Mechanical device

    Quantities will tell

    us nothing

    Concentrations (quantities)

    are all what we need


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Proteome footprinting: motivation

    Comparing only protein amounts between proteomes might be looking at the tip of the iceberg

    1. Chemical reactor versus machine

    2. Differences in protein amounts do not show immediately in many cases, unlike changes in conformations or interactions

    Need to develop quantitative approaches to monitor changes in protein surfaces in vivo


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Protein/proteome footprinting: the principle

    Protein

    Identification of modified site

    Modification

    Isolated

    Interacting

    Protease

    Mass spec

    Goals:

    1. Monitor surface of a particular protein in vivo

    2. Detect changes in protein surfaces on proteome-wide basis


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Lysine containing peptide: mono-, di- and trimethylation by DMS

    1methyl

    2methyl

    3methyl

    14


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Arginine containing peptide: mono- and dimethylation by DMS

    14

    1methyl

    2methyl


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Stable isotope DMSD6 produces a mass shift 17 instead of 14

    CH3

    14

    17

    CD3


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Discrimination between in vitro and in vivo methylation using

    stable isotopes

    KCH3

    KCD3

    KCH3


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Footprinting of H2AZ expressed in bacteria

    Total spectra

    850 + 864,867

    864 +867


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Footprinting of H2AZ expressed in bacteria

    658

    850

    1370

    TTSHGR

    HLQLAIR

    ATIAGGGVIPHIHK


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Footprinting of H2AZ/H2B dimer in vitro

    +CH3

    828.4

    +CD3

    1168.6

    850.5

    1370.8


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    A

    DMSD6

    Trypsin,

    (affinity enrichment)

    LC-MS/MS

    DMS

    Denaturation

    B

    1

    2

    3

    1

    Ctrl

    2

    5

    DMS

    3

    10

    4

    coomassie


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Conclusions

    Methodology:

    1. DMS methylates proteins in vivo

    2. Use of stable isotope DMSD6 allows to set up

    a quantitative approach to monitor reactivity

    of residues in vivo and in vitro

    3. H2AZ and H2B surfaces change after forming

    H2AZ/H2B dimer


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    2. New proteomics-based strategy to study

    protein-protein interactions in vivo

    Proximity-Utilizing-Biotinylation (PUB)


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Proximity-Utilizing-Biotinylation (PUB) for study interactions between known interaction partners

    B

    Protein А

    BAD

    Biotinilated

    I

    propionilated

    Retention time (min)

    Interaction between protein A

    and B causes biotin transfer

    and its covalent binding to

    Lysine of BAD

    wtBirA

    ProteinВ

    2. Purification of all HisTagproteins

    On Ni agarose beads, propionic

    anhydride treatment, trypsin digest

    wtBirA

    B

    Р

    Biotin ligase (wild type)

    BAD

    BAD

    BAD

    Biotin Accepting Domain

    (Short peptide with HisTag)

    3. LC-MS/MS

    Analysisof ratio

    Biotinylated/propionylated

    peptides

    Biotin residue

    B

    Propionyl residue

    P

    24


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Biotinylation levels are interaction dependent

    • Protein oligomerisation

    • (TAP54a vs HP1g)

    • 2. Binary protein-protein interaction

    • (KAP1 and HP1)

    • 3. Different subnuclear domaines

    • (macroH2A vs H2A.BBD)


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Protein oligomerisation (TAP54a vs HP1g)

    51

    28

    51

    28

    39

    39

    BAP-HP1g

    • TAP54a (RuvB-like 1) was shown to exist in oligomers

    • The heterochromatin proteins HP1 (a, b, g) are also known to oligomerise

    • But HP1 and Tap54 do not interact

    PentaHis-HRP

    Streptavidin-HRP

    NS

    1

    2

    3

    4

    1

    2

    3

    4

    1 - BAP.Tap54a+BirA.Tap54a

    2 - BAP.Tap54a+BirA.HP1g

    3 - BAP.HP1g+BirA.Tap54a

    4 - BAP. HP1g+BirA. HP1g

    BAP-TAP54a

    NS

    BAP-HP1g

    Two BAP fusions (HP1 and Tap54) coexpressed with one Bira fusion (HP1 or Tap54)

    PentaHis-HRP

    Streptavidin-HRP

    1

    2

    3

    1 - control

    2 - BAP.Tap54a + BAP.HP1g + BirA.Tap54a

    3 - BAP.Tap54a + BAP.HP1g + BirA.HP1g

    1

    2

    3

    NS

    NS

    BAP-TAP54a

    NS


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Binary protein-protein interaction (HP1 and Kap1)

    1

    1

    2

    2

    3

    3

    4

    4

    1

    2

    3

    4

    5

    6

    7

    8

    BAP.HP1g + BirA.Kap1 system

    PentaHis-HRP

    Streptavidin-HRP

    1 - BAP.HP1g+BirA.wtKap1

    2 - BAP. HP1g+BirA.mutKap1

    3 - BAP.GFP+BirA.wtKap1

    4 - BAP. GFP+BirA.mutKap1

    NS

    BAP-GFP

    BAP-HP1

    BAP.Kap1 + BirA.HP1g system

    PentaHis-HRP

    BAP-KAP1

    1,3,5,7 - BAP.wtKap1

    2,4,6,8 - BAP.mutKap1

    BAP-KAP1

    Streptavidin-HRP

    -

    Competitor

    + KAP1mut

    + KAP1wt

    - Biotin


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    a-His-HRP

    Streptavidin-HRP

    a-His-HRP

    Streptavidin-HRP

    + - + -

    + - + -

    + - + -

    + - + -

    - + - +

    - + - +

    - + - +

    - + - +

    + + - -

    + + - -

    + + - -

    + + - -

    - - + +

    - - + +

    - - + +

    - - + +

    1

    2

    3

    4

    5

    6

    7

    8

    BAP-HP1g

    BAP-HP1g

    1

    2

    3

    4

    Expt1

    Expt2

    BAP-CenpA

    0.8

    aHis-HRP

    BAP-H3.1

    0.6

    BAP-CenpA

    Streptavidin-HRP

    BirA: PCNA/GFP

    0.4

    BAP-H3.1

    + + - -

    BirA-GFP

    0.2

    - - + +

    BirA-PCNA

    + - + -

    BAP-H3.1

    H3.1

    H3.1

    CenpA

    CenpA

    0

    BAP-CenpA

    BAP:

    A

    B

    1

    2

    3

    4

    5

    6

    7

    8

    1

    2

    3

    4

    5

    6

    7

    8

    NS

    NS

    BAP-GFP

    BAP-TAP54a

    NS

    BAP-HP1

    BirA-TAP54

    BirA-KAP1BDwt

    BirA-HP1

    BirA-KAP1BDMut

    BAP-TAP54

    BAP-HP1

    BAP-HP1

    BAP-GFP

    1

    2

    3

    4

    5

    6

    NS

    BAP-KAP1

    a-His-HRP

    BAP-TAP54a

    NS

    NS

    BAP-KAP1

    Streptavidin-HRP

    - + -

    - + -

    BirA-TAP54

    • - +

    • - +

    BirA-HP1

    - + +

    - + +

    -

    Competitor

    BAP-TAP54

    + KAP1mut

    + KAP1wt

    - + +

    - + +

    - Biotin

    BAP-HP1

    C

    BirA-PCNA

    +

    BAP-H3.1

    BirA-PCNA

    +

    BAP-CenpA

    - + - +

    Biotin

    DIC


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Proximity-Utilizing-Biotinylation (PUB) for study interactions between known interaction partners

    • Advantage of PUB

    • Possibility to use mass spectrometry instead of western blotting to detect biotinylation

      • Can use multiplexing

      • Can use stable isotopes


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    B

    H2Az

    BAD

    100%

    % of biotinylation

    50%

    1

    2

    3

    4

    Structure of different types ofBAD domains

    Linear region

    Interaction strength

    BAD

    BAD1070: M GH H H H H H HG L TRI L E A QKI VRG G L E

    BAD1118: M GH H H H H H HG L TRI L E A QKI FRG G L E

    BAD1135: M GH H H H H H HG L TRI L E A QKIYRG G L E

    trypsin

    30


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    MRM of ions with m/z 648 and 563

    BAD1070 Biotinylated

    BAD1070

    Propionylated

    P

    B

    b-seria

    I L E A QKI VR

    I L E A QK IVR

    y-seria

    N-terminus

    С-terminus

    N-terminus

    С-terminus

    Р

    B

    BAD 1070

    BAD 1070


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    MRM of ions with m/z 672 (BAD1118) and 680 (BAD1135)

    BAD1135

    Biotinylated

    BAD1118

    Biotinylated

    1185.7

    B

    B

    I L E A QKI YR

    I L E A QK I FR

    H2A.BirA + H2AZ.BAD

    Streptavidin-HRP

    Anti-His-HRP

    2

    3

    1

    3

    2

    1

    2

    3

    1

    3

    2

    1

    2

    3

    1

    Ubi-b-H2AZ

    Ubi-b-H2AZ

    b-H2AZ

    b-H2AZ

    Input

    FlowThrough

    Elution

    FlowThrough

    Elution

    32


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    b6

    b8

    b7

    b2

    b4

    b3

    I L E A Q K(Pr) I V R

    y3

    y2

    y4

    y7

    y6

    y5

    y8

    Intens.

    7

    y7

    x10

    +MS2(563.2), 6.2min

    y6

    1.0

    y2

    y4

    y5

    b2

    b8

    y3

    b7

    b4

    y8

    b3

    b6

    0.0

    m/z

    400

    600

    800

    1000

    200

    b6

    b8

    b7

    b2

    b4

    b3

    I L E A Q K(Biot) I V R

    y3

    y2

    y4

    y7

    AGAATCCTGGAAGCTCAGAAGATCGTGAGAGGAGGCCTCGAG…

    R I L E A Q K I V R G G L E

    y6

    y5

    y8

    BAP1070

    Intens.

    5

    b8

    y6

    AGAATCCTGGAAGCTCAGAAGATCTTCAGAGGAGGCCTCGAG…

    R I L E A Q K I F R G G L E

    x10

    BAP1118

    +MS2(648.8), 6.6min

    y3

    y2

    y4

    y7

    2.0

    b7

    AGAATCCTGGAAGCTCAGAAGATCTACAGAGGAGGCCTCGAG…

    R I L E A Q K I Y R G G L E

    b2

    BAP1135

    y8++

    y5

    b6

    y6++

    1.0

    b3

    b4

    y8

    0.0

    400

    600

    800

    1000

    m/z

    200

    b

    a

    c

    Experimental scheme

    c. Incubation on Ni2+-NTA agarose

    a. 4hr biotin pulse before harvest

    CMV.H2Az.BAP1070

    pOz.H2A.BirA

    CMV.H2Az.BAP1118

    c. Wash, ON trypsin and LC-MS/MS

    b. Mix 3 samples

    CMV.H2Az.BAP1135

    d

    e

    M

    In

    FT

    El

    In

    FT

    El

    BAP1070 propionylated

    MS2(563.2)

    BAP1070 biotinylated

    MS2(648.8)

    Ub-H2AZ

    BAP1118 propionylated

    MS2(587.2)

    H2AZ

    BAP1118 biotinylated

    MS2(672.8)

    Coomassie Blue

    Streptavidin-HRP

    BAP1135 propionylated

    MS2(623.3)

    Ni-NTA purification

    BAP1135 biotinylated

    MS2(708.4)

    Figure 3

    2

    4

    6

    8

    10

    12

    Time [min]


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Identification of Light and Heavy peptides

    y7

    HEAVY propionylated peptide from BAD1070

    LIGHT

    biotinylated

    y6

    y4

    y3

    y2

    b8

    b7

    y5

    HEAVY

    propionylated

    y7

    LIGHT propionylated peptide from BAD1070

    LIGHT

    Propionylated

    10’ biotin pulse

    y6

    y5

    y3

    b8

    y2

    b7

    y4


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Analysis of a specific sub-population of BAP-fusion

    UV 20 J/m2

    Streptavidin pulldown

    5 min biotin

    Elu

    BirA-POLH

    +

    BAP-PCNA

    FT

    48 hr

    6 hr

    B

    BirA-POLHwt

    BirA-POLHwt

    BirA-GFP

    Bir-AGFP

    UT

    Ub-BAP-PCNA

    BAP-PCNA

    PCNA

    1

    2

    3

    4

    5

    FT

    Elu

    A

    C

    1

    2

    3

    4

    5

    6

    7

    8

    9

    10

    6XHis-HRP

    +

    +

    +

    +

    +

    +

    -

    +

    -

    +

    UV

    Ub-BAP-PCNA

    BAP-PCNA

    BirA-GFP

    BirA-PolHwt

    BirA-POLHΔΔ

    aPCNA

    -

    -

    -

    +

    +

    BirA-POLHwt

    -

    -

    -

    -

    +

    BirA-POLHΔΔ

    -

    -

    -

    -

    +

    BirA-POLH.PIP

    -

    -

    -

    -

    +

    BirA-POLH.UBZ

    -

    +

    +

    +

    +

    BAP-PCNA

    -

    +

    -

    -

    -

    BAP-PCNAmut


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    3- PUB-NChIP

    Proximity Utilizing Biotinylation (PUB)

    &

    Native Chromatin Immunoprecipitation (NChIP)

    Current Approaches to Study Histone PTMs in Proximity to DNA Damage & Repair

    Classic ChIP

    using DDR implicatedchromatinprotein

    NChIP

    using α-Histone PTM

    No need to crosslink

    use the DNA-histone interactions

    Crosslinking is necessary

    Protein part is damaged

    Any DNA couldbedamaged

    PUB-NChIP

    In Vivo biotinylation approach to study chromatin in proximity of a protein of interest


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    3- PUB-NChIP

    ProximityUtilizing Biotinylation (PUB)

    Biotin

    BirA

    ..

    ..

    BirA

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    BAP

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    BirA: Biotin Ligase

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    BAP: Biotin Accepting Peptide

    ..

    ..

    Y

    Y

    Y

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    ..

    BAP

    ..

    ..

    ..

    ..

    X

    X

    X

    Kulyyassov A, Shoaib M, et al. J Proteome Res. 2011 Sep 2

    PUB-NChIP

    BirA.X

    BAP.Histone (Biotinylated)

    ..

    Biotinylated chromatin can be purified

    BirA.X

    Cotransfection with

    BAP.Histone

    Histone

    Biotin


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    -

    -

    -

    -

    +

    +

    +

    +

    PUB-nChIP

    3- PUB-NChIP

    Rad18 Proximal ChromatinisSpecificallyBiotinylated

    BirA.Rad18 + BAP.H2A

    biotin

    combined

    αRad18

    αHis-HRP

    HEK – 293T cells

    αH2A

    combined

    biotin

    Streptavidin

    HRP

    -

    -

    +

    +

    BirA-Rad18

    6 h after UVC (20 J/m2)

    15 min Biotin Pulse

    BAP-H3.1

    BAP-H2A

    BirA: Biotin Ligase

    BAP: Biotin Accepting Peptide


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    PUB-nChIP

    3- PUB-NChIP

    Chromatin Purification in PUB-NChIP

    Flowthrough

    Supernatant

    Pellet

    Input

    Elution

    MNase

    EthBrStaining

    15 min Biotin Pulse beforeharvesting

    Harvestcells and prepareNuclei

    Tri

    500 bp

    Di

    300 bp

    200 bp

    Mono

    MicrococcalNuclease Digestion

    WB: Streptavidin-HRP

    30 kDa

    BAP.H2A

    12 kDa

    0.4 M salt extraction of nucleosomes

    Coomassie Blue Staining

    20 kDa

    BAP.H2A

    3h binding of nucleosomes in Sepharose-Streptavidinbeads

    H3

    H2B

    12 kDa

    H2A

    H4 + Streptavidin

    Elution of Biotinylated H2A alongwithother histones


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    α -H3

    α - γH2AX

    PUB-nChIP

    3- PUB-NChIP

    ChromatinPurified by PUB-NChIP isEnriched in ExpectedPTMs

    BAP-H2A

    γH2AX

    biotin

    combined

    +

    BirA-RAD18

    HEK 293T cells

    + -

    BirA-RAD18

    - +

    BirA-HP1α

    BirA-HP1α

    + +

    BAP-H2A

    3 h afterIonizing Radiation (10 Gy)

    15 min Biotin Pulse


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    PUB-nChIP

    3- PUB-NChIP

    PUB-NChIP Reveals a Specific Pattern of H4 Acetylation in Rad18 Proximal Chromatin

    BirA.GFP cotransfectedwith BAP.H2A control

    Biotinylateseverything

    H

    H

    L

    BirA.GFP + BAP.H2A

    BirA.GFP

    BAP.H2A

    BirA.Rad18

    BAP.H2A

    BirA.GFP

    BAP.H2A

    SILAC Experimental Design

    HEK 293T cells

    GFP

    Biotin

    1 : 1

    1 : 1

    1

    2

    MS analysis of Histone H4 peptide 4-17

    (GKGGKGLGKGGAKR)

    H/L ratios

    HEK-293T cells

    H/L ratios

    1 2

    1Ac

    2Ac

    3Ac

    4Ac

    UM

    1- GFP+H2A (H) / GFP+H2A (L)

    2- Rad18+H2A (H) / GFP+H2A (L)


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    PUB-nChIP

    3- PUB-NChIP

    Proximity of BiotinylatedChromatinwith Rad18 isDiminishedafter 6h Chase

    BirA.Rad18 + BAP.H2A

    Overlap

    Rad18

    Biotin

    Pulse

    BirA.Rad18

    Rad18

    Biotin

    Overlap

    BAP.H3

    BAP.H2A

    25kDa

    α6XHis-HRP

    HEK – 293T cells

    Chase

    25kDa

    Streptavidin-HRP

    Chase

    Chase

    Pulse

    Pulse

    Zoom

    6h after UVC (20 J/m2)

    15 min Biotin Pulse

    FixedImmediately

    PULSE Sample

    Fixed 6h later

    CHASE SAMPLE


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    3- PUB-NChIP

    Rad18 Specific Pattern Changes afterProximitywith Rad18 isDiminished

    SILAC Experimental Design

    H

    H

    L

    BirA.GFP

    BAP.H2A

    BirA.Rad18

    BAP.H2A

    BirA.GFP

    BAP.H2A

    Pulse Samples

    1 : 1

    1 : 1

    MS analysis of Histone H4 peptide 4-17 (GKGGKGLGKGGAKR)

    2

    1

    H

    H

    1 : 1

    1 : 1

    BirA.Rad18

    BAP.H2A

    BirA.GFP

    BAP.H2A

    4

    3

    Chase samples

    HEK-293T cells

    H/L ratios

    UVC: 20 J/m2

    1.4

    15 min Biotin Pulse after 6 h of UVC

    1

    0.6

    Pulse samples, Biotinwasremoved, cellswashed and

    harvestedimmediately

    1- GFP+H2A (H) / GFP+H2A (L)

    2- Rad18+H2A (H) / GFP+H2A (L)

    3- GFP+H2A (H) / GFP+H2A (L)

    4- Rad18+H2A (H) / GFP+H2A (L)

    Pulse

    0.2

    0

    Chase samples, Biotinwasremoved, cellswashed, reincubated in normal medium, harvestedafter 6h

    1 2 3 4

    Chase

    1Ac

    2Ac

    3Ac

    4Ac

    UM


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    3- PUB-NChIP

    PUB-NChIP to Study Alternative Chromatin States

    BirA-Rad18

    +

    αRad18

    streptavidin

    Combined

    BAP-H2AZub

    BAP-H2ABBD

    BAP-H2AZ

    BirA-Rad18

    - + - +

    - - + +

    BAP-H2AZ

    Streptavidin

    HRP

    BAP-MacroH2A

    HEK – 293T cells

    BAP-mH2A

    Streptavidin

    HRP

    BAP-H2AZ

    BAP-H2ABBD

    + - - + - -

    BirA-Rad18

    + + - - - -

    BAP-H2ABBD

    6 h after UVC (20 J/m2)

    15 min Biotin Pulse

    - - - + + -

    BAP-mH2A


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    3- PUB-NChIP

    Pattern of H4 Acetylationnear Rad18 isDifferent in H2AZ ContainingChromatin

    H

    H

    L

    BirA.GFP

    BAP.H2A

    BirA.Rad18

    BAP.H2A

    BirA.GFP

    BAP.H2A

    SILAC Experimental Design

    MS analysis of Histone H4 peptide 4-17 (GKGGKGLGKGGAKR)

    1 : 1

    1 : 1

    H

    H

    2

    1

    BirA.Rad18

    BAP.H2AZ

    BirA.GFP

    BAP.H2AZ

    1 : 1

    1 : 1

    3

    4

    H/L ratios

    1- GFP+H2A (H) / GFP+H2A (L)

    2- Rad18+H2A (H) / GFP+H2A (L)

    3- GFP+H2AZ (H) / GFP+H2A (L)

    4- Rad18+H2AZ (H) / GFP+H2A (L)

    H2A

    H2AZ

    HEK-293T cells

    UVC: 20 J/m2

    15 min Biotin Pulse

    after 6h of UVC

    1 2 3 4

    1Ac

    2Ac

    3Ac

    4Ac

    UM


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    H6

    H2

    Tumor heterogeneity requires Single-Cell analysis

    Cellular variability

    Heritable

    Nonheritable

    Stochasticity at the level of individual cells

    Genetic

    Epigenetic

    Parkhomchuk D et al. Use of high throughput sequencing to observe genome dynamics at a single cell level.

    Proc Natl Acad Sci U S A. 2009 Dec 8;106(49):20830-5

    The statistics of distances between successive mutations in experimental samples is compared with simulated random mutations.

    R1(49)

    R2(17)

    R3(24)

    VMR (Fano factor) –

    variance to mean ratio

    H3(81)

    H4(80)

    H6(54)

    H5(83)

    H1(41)

    H2(31)

    0.6

    1.0

    1.4

    1.8


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Use of PUB to study epigenetic variability

    PUB allows to study the protein of interest at defined time after the interaction took place

    Pulse labeling with biotin

    BirA-Emerin

    + BAP-H2A

    BirA-Nurim

    + BAP-H2A

    biotin

    Nurim-GFP

    Emerin-GFP

    GFP

    GFP

    biotin

    A

    Biotin

    GFP

    DAPI

    B

    Pulse – chase setup:

    Cells are labeled with biotin for 5’,

    then washed and allowed to enter mitosis

    The chromatin domains that were proximal to nuclear envelope in the interphase appear as discrete bands on mitotic chromosomes


    Development of proteomics tools to study intranuclear organization vasily ogryzko

    Acknowledgements

    Collaborators:

    Group members:

    Undine Mechold

    Martine Comisso

    Antoine Viens

    Shoaib Muhammad

    Evelyne Saade

    Damien Vertut

    Arman Kulyyassov

    Chloe Robin

    Pasquale Moio

    Franck Broouillard

    Patricia Kannouche


  • Login