slide1
Download
Skip this Video
Download Presentation
Development of proteomics tools to study intranuclear organization Vasily Ogryzko

Loading in 2 Seconds...

play fullscreen
1 / 48

Development of proteomics tools to study intranuclear organization Vasily Ogryzko - PowerPoint PPT Presentation


  • 186 Views
  • Uploaded on

Development of proteomics tools to study intranuclear organization Vasily Ogryzko Group of “Proteomics & epigenetics ’, UMR 8126 CNRS, Institut Gustave Roussy 15 мая 2014 Программа визитов иностранных учёных в российские научные центры фонда "Династия". Importance of proteomics.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Development of proteomics tools to study intranuclear organization Vasily Ogryzko' - umed


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

Development of proteomics tools to study intranuclearorganization

Vasily Ogryzko

Group of “Proteomics & epigenetics’, UMR 8126 CNRS, Institut Gustave Roussy

15 мая 2014

Программа визитов иностранных учёных в российские научные центры фонда "Династия"

slide2

Importance of proteomics

One genome

Two proteomes

slide3

Proteomics:

High throughput

Study of proteins

Questions:

Amounts

Localization

Modifications

Interactions

Methodology:

2D electrophoresis

Mass spectrometry

Epitope tagging

Proteins:

Structure Levels

slide4

Challenges of postgenomic era:

  • Study post-transcriptional steps in gene regulation

(microRNA, etc)

    • Decipher mechanisms of epigenetic regulation
  • (histone code, other self-perpetuating protein modifications)
  • Predict function of newly discovered genes
  • (protein-protein interaction partners)

can be addressed by proteomics

slide5

Healthcare - Research - Education

International Scientific Advisory Board

Hospital Activities

Research Division

Clinical Research Division

(DRC)

Research Units

(IRCIV)

slide6

Technology Transfert Company

Research Division

Eric Solary

Scientific Policy Committee

Research Coordination and Management Service / Logistics Service

Clinical Research

Gilles Vassal

Platforms

Jean-Yves Scoazec

Imaging / flow cytometry

Animal facility

Integrated biology

Translational research

Tumor collection

Biotherapies

Bioinformatics

Research Units

Eric Solary

Steering Committee

Steering Committee

slide7

Proteomicsplatform at IGR

Metabolomics

platform

Integrated

Biology

Functional

genomics

platform

Lipidomics

platform

Biological resources

center

Bioinformatics

platform

Proteomics

platform

slide8

Proteomicsplatform at IGR

Personnel:

Vasily OGRYZKO– DR2, INSERM

Alain DEROUSSENT– IR, CNRS

Emilie COCHET– Technicienne, IGR

Geographic location:

IGR, PR2, room 355

slide9

Proteomicsplatform at IGR

Main instrument:

Nano-HPLC/CHIP/ion-trap (Agilent)

+

Agilent off-gel separator for preanalytic fractionation

+

Small laboratory equipment

slide10

1. Protein footprinting: motivation

Epigenetic information can be encoded in macromolecular interactions

Proteins are much more interesting objects than DNA or RNA, i.e. not only their amounts but their conformation and interaction plays essential role

slide11

Protein footprinting: motivation

Biological system as:

Chemical reactor

Mechanical device

Quantities will tell

us nothing

Concentrations (quantities)

are all what we need

slide12

Proteome footprinting: motivation

Comparing only protein amounts between proteomes might be looking at the tip of the iceberg

1. Chemical reactor versus machine

2. Differences in protein amounts do not show immediately in many cases, unlike changes in conformations or interactions

Need to develop quantitative approaches to monitor changes in protein surfaces in vivo

slide13

Protein/proteome footprinting: the principle

Protein

Identification of modified site

Modification

Isolated

Interacting

Protease

Mass spec

Goals:

1. Monitor surface of a particular protein in vivo

2. Detect changes in protein surfaces on proteome-wide basis

slide18

Footprinting of H2AZ expressed in bacteria

Total spectra

850 + 864,867

864 +867

slide19

Footprinting of H2AZ expressed in bacteria

658

850

1370

TTSHGR

HLQLAIR

ATIAGGGVIPHIHK

slide20

Footprinting of H2AZ/H2B dimer in vitro

+CH3

828.4

+CD3

1168.6

850.5

1370.8

slide21

A

DMSD6

Trypsin,

(affinity enrichment)

LC-MS/MS

DMS

Denaturation

B

1

2

3

1

Ctrl

2

5

DMS

3

10

4

coomassie

slide22

Conclusions

Methodology:

1. DMS methylates proteins in vivo

2. Use of stable isotope DMSD6 allows to set up

a quantitative approach to monitor reactivity

of residues in vivo and in vitro

3. H2AZ and H2B surfaces change after forming

H2AZ/H2B dimer

slide23

2. New proteomics-based strategy to study

protein-protein interactions in vivo

Proximity-Utilizing-Biotinylation (PUB)

slide24

Proximity-Utilizing-Biotinylation (PUB) for study interactions between known interaction partners

B

Protein А

BAD

Biotinilated

I

propionilated

Retention time (min)

Interaction between protein A

and B causes biotin transfer

and its covalent binding to

Lysine of BAD

wtBirA

ProteinВ

2. Purification of all HisTagproteins

On Ni agarose beads, propionic

anhydride treatment, trypsin digest

wtBirA

B

Р

Biotin ligase (wild type)

BAD

BAD

BAD

Biotin Accepting Domain

(Short peptide with HisTag)

3. LC-MS/MS

Analysisof ratio

Biotinylated/propionylated

peptides

Biotin residue

B

Propionyl residue

P

24

slide25

Biotinylation levels are interaction dependent

  • Protein oligomerisation
  • (TAP54a vs HP1g)
  • 2. Binary protein-protein interaction
  • (KAP1 and HP1)
  • 3. Different subnuclear domaines
  • (macroH2A vs H2A.BBD)
slide26

Protein oligomerisation (TAP54a vs HP1g)

51

28

51

28

39

39

BAP-HP1g

  • TAP54a (RuvB-like 1) was shown to exist in oligomers
  • The heterochromatin proteins HP1 (a, b, g) are also known to oligomerise
  • But HP1 and Tap54 do not interact

PentaHis-HRP

Streptavidin-HRP

NS

1

2

3

4

1

2

3

4

1 - BAP.Tap54a+BirA.Tap54a

2 - BAP.Tap54a+BirA.HP1g

3 - BAP.HP1g+BirA.Tap54a

4 - BAP. HP1g+BirA. HP1g

BAP-TAP54a

NS

BAP-HP1g

Two BAP fusions (HP1 and Tap54) coexpressed with one Bira fusion (HP1 or Tap54)

PentaHis-HRP

Streptavidin-HRP

1

2

3

1 - control

2 - BAP.Tap54a + BAP.HP1g + BirA.Tap54a

3 - BAP.Tap54a + BAP.HP1g + BirA.HP1g

1

2

3

NS

NS

BAP-TAP54a

NS

slide27

Binary protein-protein interaction (HP1 and Kap1)

1

1

2

2

3

3

4

4

1

2

3

4

5

6

7

8

BAP.HP1g + BirA.Kap1 system

PentaHis-HRP

Streptavidin-HRP

1 - BAP.HP1g+BirA.wtKap1

2 - BAP. HP1g+BirA.mutKap1

3 - BAP.GFP+BirA.wtKap1

4 - BAP. GFP+BirA.mutKap1

NS

BAP-GFP

BAP-HP1

BAP.Kap1 + BirA.HP1g system

PentaHis-HRP

BAP-KAP1

1,3,5,7 - BAP.wtKap1

2,4,6,8 - BAP.mutKap1

BAP-KAP1

Streptavidin-HRP

-

Competitor

+ KAP1mut

+ KAP1wt

- Biotin

slide28

a-His-HRP

Streptavidin-HRP

a-His-HRP

Streptavidin-HRP

+ - + -

+ - + -

+ - + -

+ - + -

- + - +

- + - +

- + - +

- + - +

+ + - -

+ + - -

+ + - -

+ + - -

- - + +

- - + +

- - + +

- - + +

1

2

3

4

5

6

7

8

BAP-HP1g

BAP-HP1g

1

2

3

4

Expt1

Expt2

BAP-CenpA

0.8

aHis-HRP

BAP-H3.1

0.6

BAP-CenpA

Streptavidin-HRP

BirA: PCNA/GFP

0.4

BAP-H3.1

+ + - -

BirA-GFP

0.2

- - + +

BirA-PCNA

+ - + -

BAP-H3.1

H3.1

H3.1

CenpA

CenpA

0

BAP-CenpA

BAP:

A

B

1

2

3

4

5

6

7

8

1

2

3

4

5

6

7

8

NS

NS

BAP-GFP

BAP-TAP54a

NS

BAP-HP1

BirA-TAP54

BirA-KAP1BDwt

BirA-HP1

BirA-KAP1BDMut

BAP-TAP54

BAP-HP1

BAP-HP1

BAP-GFP

1

2

3

4

5

6

NS

BAP-KAP1

a-His-HRP

BAP-TAP54a

NS

NS

BAP-KAP1

Streptavidin-HRP

- + -

- + -

BirA-TAP54

  • - +
  • - +

BirA-HP1

- + +

- + +

-

Competitor

BAP-TAP54

+ KAP1mut

+ KAP1wt

- + +

- + +

- Biotin

BAP-HP1

C

BirA-PCNA

+

BAP-H3.1

BirA-PCNA

+

BAP-CenpA

- + - +

Biotin

DIC

slide29

Proximity-Utilizing-Biotinylation (PUB) for study interactions between known interaction partners

  • Advantage of PUB
  • Possibility to use mass spectrometry instead of western blotting to detect biotinylation
        • Can use multiplexing
        • Can use stable isotopes
slide30

B

H2Az

BAD

100%

% of biotinylation

50%

1

2

3

4

Structure of different types ofBAD domains

Linear region

Interaction strength

BAD

BAD1070: M GH H H H H H HG L TRI L E A QKI VRG G L E

BAD1118: M GH H H H H H HG L TRI L E A QKI FRG G L E

BAD1135: M GH H H H H H HG L TRI L E A QKIYRG G L E

trypsin

30

slide31

MRM of ions with m/z 648 and 563

BAD1070 Biotinylated

BAD1070

Propionylated

P

B

b-seria

I L E A QKI VR

I L E A QK IVR

y-seria

N-terminus

С-terminus

N-terminus

С-terminus

Р

B

BAD 1070

BAD 1070

slide32

MRM of ions with m/z 672 (BAD1118) and 680 (BAD1135)

BAD1135

Biotinylated

BAD1118

Biotinylated

1185.7

B

B

I L E A QKI YR

I L E A QK I FR

H2A.BirA + H2AZ.BAD

Streptavidin-HRP

Anti-His-HRP

2

3

1

3

2

1

2

3

1

3

2

1

2

3

1

Ubi-b-H2AZ

Ubi-b-H2AZ

b-H2AZ

b-H2AZ

Input

FlowThrough

Elution

FlowThrough

Elution

32

slide33

b6

b8

b7

b2

b4

b3

I L E A Q K(Pr) I V R

y3

y2

y4

y7

y6

y5

y8

Intens.

7

y7

x10

+MS2(563.2), 6.2min

y6

1.0

y2

y4

y5

b2

b8

y3

b7

b4

y8

b3

b6

0.0

m/z

400

600

800

1000

200

b6

b8

b7

b2

b4

b3

I L E A Q K(Biot) I V R

y3

y2

y4

y7

AGAATCCTGGAAGCTCAGAAGATCGTGAGAGGAGGCCTCGAG…

R I L E A Q K I V R G G L E

y6

y5

y8

BAP1070

Intens.

5

b8

y6

AGAATCCTGGAAGCTCAGAAGATCTTCAGAGGAGGCCTCGAG…

R I L E A Q K I F R G G L E

x10

BAP1118

+MS2(648.8), 6.6min

y3

y2

y4

y7

2.0

b7

AGAATCCTGGAAGCTCAGAAGATCTACAGAGGAGGCCTCGAG…

R I L E A Q K I Y R G G L E

b2

BAP1135

y8++

y5

b6

y6++

1.0

b3

b4

y8

0.0

400

600

800

1000

m/z

200

b

a

c

Experimental scheme

c. Incubation on Ni2+-NTA agarose

a. 4hr biotin pulse before harvest

CMV.H2Az.BAP1070

pOz.H2A.BirA

CMV.H2Az.BAP1118

c. Wash, ON trypsin and LC-MS/MS

b. Mix 3 samples

CMV.H2Az.BAP1135

d

e

M

In

FT

El

In

FT

El

BAP1070 propionylated

MS2(563.2)

BAP1070 biotinylated

MS2(648.8)

Ub-H2AZ

BAP1118 propionylated

MS2(587.2)

H2AZ

BAP1118 biotinylated

MS2(672.8)

Coomassie Blue

Streptavidin-HRP

BAP1135 propionylated

MS2(623.3)

Ni-NTA purification

BAP1135 biotinylated

MS2(708.4)

Figure 3

2

4

6

8

10

12

Time [min]

slide34

Identification of Light and Heavy peptides

y7

HEAVY propionylated peptide from BAD1070

LIGHT

biotinylated

y6

y4

y3

y2

b8

b7

y5

HEAVY

propionylated

y7

LIGHT propionylated peptide from BAD1070

LIGHT

Propionylated

10’ biotin pulse

y6

y5

y3

b8

y2

b7

y4

slide35

Analysis of a specific sub-population of BAP-fusion

UV 20 J/m2

Streptavidin pulldown

5 min biotin

Elu

BirA-POLH

+

BAP-PCNA

FT

48 hr

6 hr

B

BirA-POLHwt

BirA-POLHwt

BirA-GFP

Bir-AGFP

UT

Ub-BAP-PCNA

BAP-PCNA

PCNA

1

2

3

4

5

FT

Elu

A

C

1

2

3

4

5

6

7

8

9

10

6XHis-HRP

+

+

+

+

+

+

-

+

-

+

UV

Ub-BAP-PCNA

BAP-PCNA

BirA-GFP

BirA-PolHwt

BirA-POLHΔΔ

aPCNA

-

-

-

+

+

BirA-POLHwt

-

-

-

-

+

BirA-POLHΔΔ

-

-

-

-

+

BirA-POLH.PIP

-

-

-

-

+

BirA-POLH.UBZ

-

+

+

+

+

BAP-PCNA

-

+

-

-

-

BAP-PCNAmut

slide36

3- PUB-NChIP

Proximity Utilizing Biotinylation (PUB)

&

Native Chromatin Immunoprecipitation (NChIP)

Current Approaches to Study Histone PTMs in Proximity to DNA Damage & Repair

Classic ChIP

using DDR implicatedchromatinprotein

NChIP

using α-Histone PTM

No need to crosslink

use the DNA-histone interactions

Crosslinking is necessary

Protein part is damaged

Any DNA couldbedamaged

PUB-NChIP

In Vivo biotinylation approach to study chromatin in proximity of a protein of interest

slide37

3- PUB-NChIP

ProximityUtilizing Biotinylation (PUB)

Biotin

BirA

..

..

BirA

..

..

..

..

..

..

..

..

..

..

..

..

..

BAP

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

BirA: Biotin Ligase

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

BAP: Biotin Accepting Peptide

..

..

Y

Y

Y

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

..

BAP

..

..

..

..

X

X

X

Kulyyassov A, Shoaib M, et al. J Proteome Res. 2011 Sep 2

PUB-NChIP

BirA.X

BAP.Histone (Biotinylated)

..

Biotinylated chromatin can be purified

BirA.X

Cotransfection with

BAP.Histone

Histone

Biotin

slide38

-

-

-

-

+

+

+

+

PUB-nChIP

3- PUB-NChIP

Rad18 Proximal ChromatinisSpecificallyBiotinylated

BirA.Rad18 + BAP.H2A

biotin

combined

αRad18

αHis-HRP

HEK – 293T cells

αH2A

combined

biotin

Streptavidin

HRP

-

-

+

+

BirA-Rad18

6 h after UVC (20 J/m2)

15 min Biotin Pulse

BAP-H3.1

BAP-H2A

BirA: Biotin Ligase

BAP: Biotin Accepting Peptide

slide39

PUB-nChIP

3- PUB-NChIP

Chromatin Purification in PUB-NChIP

Flowthrough

Supernatant

Pellet

Input

Elution

MNase

EthBrStaining

15 min Biotin Pulse beforeharvesting

Harvestcells and prepareNuclei

Tri

500 bp

Di

300 bp

200 bp

Mono

MicrococcalNuclease Digestion

WB: Streptavidin-HRP

30 kDa

BAP.H2A

12 kDa

0.4 M salt extraction of nucleosomes

Coomassie Blue Staining

20 kDa

BAP.H2A

3h binding of nucleosomes in Sepharose-Streptavidinbeads

H3

H2B

12 kDa

H2A

H4 + Streptavidin

Elution of Biotinylated H2A alongwithother histones

slide40

α -H3

α - γH2AX

PUB-nChIP

3- PUB-NChIP

ChromatinPurified by PUB-NChIP isEnriched in ExpectedPTMs

BAP-H2A

γH2AX

biotin

combined

+

BirA-RAD18

HEK 293T cells

+ -

BirA-RAD18

- +

BirA-HP1α

BirA-HP1α

+ +

BAP-H2A

3 h afterIonizing Radiation (10 Gy)

15 min Biotin Pulse

slide41

PUB-nChIP

3- PUB-NChIP

PUB-NChIP Reveals a Specific Pattern of H4 Acetylation in Rad18 Proximal Chromatin

BirA.GFP cotransfectedwith BAP.H2A control

Biotinylateseverything

H

H

L

BirA.GFP + BAP.H2A

BirA.GFP

BAP.H2A

BirA.Rad18

BAP.H2A

BirA.GFP

BAP.H2A

SILAC Experimental Design

HEK 293T cells

GFP

Biotin

1 : 1

1 : 1

1

2

MS analysis of Histone H4 peptide 4-17

(GKGGKGLGKGGAKR)

H/L ratios

HEK-293T cells

H/L ratios

1 2

1Ac

2Ac

3Ac

4Ac

UM

1- GFP+H2A (H) / GFP+H2A (L)

2- Rad18+H2A (H) / GFP+H2A (L)

slide42

PUB-nChIP

3- PUB-NChIP

Proximity of BiotinylatedChromatinwith Rad18 isDiminishedafter 6h Chase

BirA.Rad18 + BAP.H2A

Overlap

Rad18

Biotin

Pulse

BirA.Rad18

Rad18

Biotin

Overlap

BAP.H3

BAP.H2A

25kDa

α6XHis-HRP

HEK – 293T cells

Chase

25kDa

Streptavidin-HRP

Chase

Chase

Pulse

Pulse

Zoom

6h after UVC (20 J/m2)

15 min Biotin Pulse

FixedImmediately

PULSE Sample

Fixed 6h later

CHASE SAMPLE

slide43

3- PUB-NChIP

Rad18 Specific Pattern Changes afterProximitywith Rad18 isDiminished

SILAC Experimental Design

H

H

L

BirA.GFP

BAP.H2A

BirA.Rad18

BAP.H2A

BirA.GFP

BAP.H2A

Pulse Samples

1 : 1

1 : 1

MS analysis of Histone H4 peptide 4-17 (GKGGKGLGKGGAKR)

2

1

H

H

1 : 1

1 : 1

BirA.Rad18

BAP.H2A

BirA.GFP

BAP.H2A

4

3

Chase samples

HEK-293T cells

H/L ratios

UVC: 20 J/m2

1.4

15 min Biotin Pulse after 6 h of UVC

1

0.6

Pulse samples, Biotinwasremoved, cellswashed and

harvestedimmediately

1- GFP+H2A (H) / GFP+H2A (L)

2- Rad18+H2A (H) / GFP+H2A (L)

3- GFP+H2A (H) / GFP+H2A (L)

4- Rad18+H2A (H) / GFP+H2A (L)

Pulse

0.2

0

Chase samples, Biotinwasremoved, cellswashed, reincubated in normal medium, harvestedafter 6h

1 2 3 4

Chase

1Ac

2Ac

3Ac

4Ac

UM

slide44

3- PUB-NChIP

PUB-NChIP to Study Alternative Chromatin States

BirA-Rad18

+

αRad18

streptavidin

Combined

BAP-H2AZub

BAP-H2ABBD

BAP-H2AZ

BirA-Rad18

- + - +

- - + +

BAP-H2AZ

Streptavidin

HRP

BAP-MacroH2A

HEK – 293T cells

BAP-mH2A

Streptavidin

HRP

BAP-H2AZ

BAP-H2ABBD

+ - - + - -

BirA-Rad18

+ + - - - -

BAP-H2ABBD

6 h after UVC (20 J/m2)

15 min Biotin Pulse

- - - + + -

BAP-mH2A

slide45

3- PUB-NChIP

Pattern of H4 Acetylationnear Rad18 isDifferent in H2AZ ContainingChromatin

H

H

L

BirA.GFP

BAP.H2A

BirA.Rad18

BAP.H2A

BirA.GFP

BAP.H2A

SILAC Experimental Design

MS analysis of Histone H4 peptide 4-17 (GKGGKGLGKGGAKR)

1 : 1

1 : 1

H

H

2

1

BirA.Rad18

BAP.H2AZ

BirA.GFP

BAP.H2AZ

1 : 1

1 : 1

3

4

H/L ratios

1- GFP+H2A (H) / GFP+H2A (L)

2- Rad18+H2A (H) / GFP+H2A (L)

3- GFP+H2AZ (H) / GFP+H2A (L)

4- Rad18+H2AZ (H) / GFP+H2A (L)

H2A

H2AZ

HEK-293T cells

UVC: 20 J/m2

15 min Biotin Pulse

after 6h of UVC

1 2 3 4

1Ac

2Ac

3Ac

4Ac

UM

slide46

H6

H2

Tumor heterogeneity requires Single-Cell analysis

Cellular variability

Heritable

Nonheritable

Stochasticity at the level of individual cells

Genetic

Epigenetic

Parkhomchuk D et al. Use of high throughput sequencing to observe genome dynamics at a single cell level.

Proc Natl Acad Sci U S A. 2009 Dec 8;106(49):20830-5

The statistics of distances between successive mutations in experimental samples is compared with simulated random mutations.

R1(49)

R2(17)

R3(24)

VMR (Fano factor) –

variance to mean ratio

H3(81)

H4(80)

H6(54)

H5(83)

H1(41)

H2(31)

0.6

1.0

1.4

1.8

slide47

Use of PUB to study epigenetic variability

PUB allows to study the protein of interest at defined time after the interaction took place

Pulse labeling with biotin

BirA-Emerin

+ BAP-H2A

BirA-Nurim

+ BAP-H2A

biotin

Nurim-GFP

Emerin-GFP

GFP

GFP

biotin

A

Biotin

GFP

DAPI

B

Pulse – chase setup:

Cells are labeled with biotin for 5’,

then washed and allowed to enter mitosis

The chromatin domains that were proximal to nuclear envelope in the interphase appear as discrete bands on mitotic chromosomes

slide48

Acknowledgements

Collaborators:

Group members:

Undine Mechold

Martine Comisso

Antoine Viens

Shoaib Muhammad

Evelyne Saade

Damien Vertut

Arman Kulyyassov

Chloe Robin

Pasquale Moio

Franck Broouillard

Patricia Kannouche

ad