1 / 43

Synthetic Biology

Synthetic Biology. Lecture 1: Introduction to Synthetic Biology. What is Synthetic Biology?. Genetic Manipulation? Genetic selection carried out for millenia (domestication of animals) Mendelian selection ‘rationalized’ process. Recombinant DNA .

tyrone
Download Presentation

Synthetic Biology

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Synthetic Biology Lecture 1: Introduction to Synthetic Biology

  2. What is Synthetic Biology? • Genetic Manipulation? • Genetic selection carried out for millenia (domestication of animals) • Mendelian selection ‘rationalized’ process. • Recombinant DNA

  3. Engineering Goal: To build components that can be reliably and predictably assembled into ever more complicated systems

  4. Fumbling Around • Current Systems are “Art”

  5. Recombinant DNA

  6. Genetic Tools

  7. Scissors

  8. Glue

  9. Vectors

  10. Synthesizing DNA

  11. These are Tools, but…

  12. We want to create complex systems

  13. EE in the beginning

  14. How useful is Maxwell?

  15. Abstraction Works for E&M

  16. Composability • OK - suppose we have individual parts that work, can we actually put them together such that they work in a well-defined/predictable way?

  17. Standardization • Assembly • Part “Definition” • Interactions • Load • Input/Output • Stability

  18. Standardizing a “Part” • BioBrick - standard ends, restrictions on internal sequence

  19. Standard Assembly

  20. Standard Assembly

  21. Now we can share!

  22. What constitutes a part? • The DNA Sequence? • The function?

  23. Parts: Basic biological functions encoded as DNA

  24. DNA Sequence • TAATACGACTCACTATAGGGAGA (T7 promoter)

  25. Load: Imposing on our Hosts • Parts don’t exist in a vacuum. • Cells may dislike the parts, resulting in mutation or rejection • Too much modification may result in cells that just give up and die

  26. Standard Measurement

  27. Our Parts aren’t necessarily Stable • Anything that adds load to a cell reduces its fitness vs. cells that ‘lose’ the part • Mutations: Losing a plasmid, alteration of promoters to not work as efficiently (or not at all) • Antibiotic resistance, dependence

  28. Application Goals • Bacterial robotics • Microbial factories • Adding features to plants to reduce environmental requirements/impact

  29. Cancer Destroying Robot

  30. Adding Computation to Cells

  31. Bacterial Communication Networks

  32. Artemisinin

  33. Public Policy http://www.repeatfanzine.co.uk/Images/Impage/no%20gmo.jpg

  34. Is the fear so Irrational? • We claim we can make all sorts of cool things, why not something ‘evil’?

  35. Major Risks

  36. What is different now? • Rapid Sequencing • Lots of sequence data on the internet • Protocols available online • Fedex Synthesis • Data on Pathogens?

  37. The good news Major weaponized biological agents have existed for decades Virulence, resistance, transmissibility were all enhanced prior to SB. The major advantage of our approach is putting together well characterized components. Creating new pathogens would require a full scale research effort

  38. Summary • Engineering instead of Science • Modularity and Abstraction are powerful techniques • Mechanical Engineering, Electrical Engineering were all at the stage where it was “too complicated”.

More Related