Designing and Building
This presentation is the property of its rightful owner.
Sponsored Links
1 / 17

RECOMB-BE PowerPoint PPT Presentation


  • 89 Views
  • Uploaded on
  • Presentation posted in: General

Designing and Building a Bacterial Computer. RECOMB-BE. [email protected] Dr. Laurie J. Heyer. July 20, 2011. Synthetic Biology.

Download Presentation

RECOMB-BE

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Recomb be

Designing and Buildinga Bacterial Computer

RECOMB-BE

[email protected]

Dr. Laurie J. Heyer

July 20, 2011


Synthetic biology

Synthetic Biology

Application of engineering principles and mathematical modeling to the design and construction of biological parts, devices, and systems with applications in energy, medicine, environment, and technology.


Hamiltonian path problem

Hamiltonian Path Problem

Is there a path that:

  • Starts at node 1

  • Ends at node 7

  • Visits each node exactly once

3

2

4

1

YES

5

7

NO

6


Hamiltonian path problem1

Hamiltonian Path Problem

Is there a path that:

  • Starts at node 1

  • Ends at node 7

  • Visits each node exactly once

3

2

4

1

YES

5

7

NO

6


A biological computer

A Biological Computer

Node = gene

Edge = 2 half-genes

1

2

3

4

5

6

7

GFP

BLa

CAT

Cre

cFP

T7

TT

4

1


A biological computer1

A Biological Computer

Use hin/hix to rearrange edges:

Hinrecombinase from

Salmonella typhimurium


A biological computer2

A Biological Computer

Use hin/hix to rearrange edges:

Hinrecombinase from

Salmonella typhimurium


Hin recombinase

HinRecombinase


Identify solutions

Identify Solutions

1

4

5

2

3

6

Terminate

GFP

Cre

cFP

CAT

T7

TT

BLa

# True Positives = (e - v + 1)! * 2(e - v + 1)

# False Positives = ?


Splitting a gene

Splitting a Gene

Reporter

Detectable

Phenotype

RBS

Promoter

Detectable

Phenotype?

Repo-

rter

RBS

hixC

Promoter

Detectable

Phenotype?

Repo-

RBS

rter

hixC

Promoter


Minimize structural disruption

Minimize Structural Disruption

GFP displaying hixC insertion point


Gene splitting strategy

Gene-Splitting Strategy

GFP-1

GFP-2

http://gcat.davidson.edu/iGEM07/genesplitter.html


Gene splitting tool

Gene Splitting Tool


Gene splitter output

Gene Splitter Output

Note: Oligos are optimized for melting temperatures.


Embed hixc with silent mutations

Embed hixC With Silent Mutations

hixC = ttatcaaaaaccatggtttttgataa

L S K T M V F D X

Y Q K P W F L I X

I K N H G F * *

^

^

^

^

^

^

^

^

Find genes with the “best” match to one of:

L S K…

… V F D a a

tY Q K…

… F L I a

L S K … V F D a a

t Y Q K … F L I a


Conclusion

Conclusion

  • Synthetic biology is an emerging bioinformatics playground

  • Biology is more efficient with automation

  • Existing tools are insufficient

    • Learn programming (Perl, Python, etc.)

    • Learn algorithms and data structures

    • Think and work across disciplinary boundaries


Acknowledgements

Acknowledgements

Malcolm Campbell (Biology, Davidson College)

Todd Eckdahl, Jeff Poet (Missouri Western State Univ.)

iGEM’06 team: Lance Harden, Karmella Haynes, SabriyaRosemond, Samantha Simpson, Erin Zwack

iGEM’07 team: OyinadeAdefuye, Will DeLoache, Jim Dickson, Andrew Martens, Amber Shoecraft, and Mike Waters

Karen Acker ’07

Phillip Compeau’08

Funding from HHMI, Davidson College, Missouri Western State University, NSF UBM DMS-0733952 and -0733955


  • Login