Designing and Building
Sponsored Links
This presentation is the property of its rightful owner.
1 / 17

RECOMB-BE PowerPoint PPT Presentation

  • Uploaded on
  • Presentation posted in: General

Designing and Building a Bacterial Computer. RECOMB-BE. Dr. Laurie J. Heyer. July 20, 2011. Synthetic Biology.

Download Presentation


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript

Recomb be

Designing and Buildinga Bacterial Computer


Dr. Laurie J. Heyer

July 20, 2011

Synthetic biology

Synthetic Biology

Application of engineering principles and mathematical modeling to the design and construction of biological parts, devices, and systems with applications in energy, medicine, environment, and technology.

Hamiltonian path problem

Hamiltonian Path Problem

Is there a path that:

  • Starts at node 1

  • Ends at node 7

  • Visits each node exactly once










Hamiltonian path problem1

Hamiltonian Path Problem

Is there a path that:

  • Starts at node 1

  • Ends at node 7

  • Visits each node exactly once










A biological computer

A Biological Computer

Node = gene

Edge = 2 half-genes

















A biological computer1

A Biological Computer

Use hin/hix to rearrange edges:

Hinrecombinase from

Salmonella typhimurium

A biological computer2

A Biological Computer

Use hin/hix to rearrange edges:

Hinrecombinase from

Salmonella typhimurium

Hin recombinase


Identify solutions

Identify Solutions















# True Positives = (e - v + 1)! * 2(e - v + 1)

# False Positives = ?

Splitting a gene

Splitting a Gene




















Minimize structural disruption

Minimize Structural Disruption

GFP displaying hixC insertion point

Gene splitting strategy

Gene-Splitting Strategy



Gene splitting tool

Gene Splitting Tool

Gene splitter output

Gene Splitter Output

Note: Oligos are optimized for melting temperatures.

Embed hixc with silent mutations

Embed hixC With Silent Mutations

hixC = ttatcaaaaaccatggtttttgataa



I K N H G F * *









Find genes with the “best” match to one of:

L S K…

… V F D a a

tY Q K…

… F L I a

L S K … V F D a a

t Y Q K … F L I a



  • Synthetic biology is an emerging bioinformatics playground

  • Biology is more efficient with automation

  • Existing tools are insufficient

    • Learn programming (Perl, Python, etc.)

    • Learn algorithms and data structures

    • Think and work across disciplinary boundaries



Malcolm Campbell (Biology, Davidson College)

Todd Eckdahl, Jeff Poet (Missouri Western State Univ.)

iGEM’06 team: Lance Harden, Karmella Haynes, SabriyaRosemond, Samantha Simpson, Erin Zwack

iGEM’07 team: OyinadeAdefuye, Will DeLoache, Jim Dickson, Andrew Martens, Amber Shoecraft, and Mike Waters

Karen Acker ’07

Phillip Compeau’08

Funding from HHMI, Davidson College, Missouri Western State University, NSF UBM DMS-0733952 and -0733955

  • Login