Da Genômica ao Melhoramento
This presentation is the property of its rightful owner.
Sponsored Links
1 / 22

Da Genômica ao Melhoramento PowerPoint PPT Presentation


  • 69 Views
  • Uploaded on
  • Presentation posted in: General

Da Genômica ao Melhoramento. Luis E. Aranha Camargo Dept. Entomologia, Fitopatologia e Zoologia Agrícola ESALQ/USP Piracicaba. Genômica. Ciência que analisa estrutura, composição e funcionalidade de genomas. Genômica. Sequenciamento. Grande volume de informação. Bioinformática.

Download Presentation

Da Genômica ao Melhoramento

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Da gen mica ao melhoramento

Da Genômica ao Melhoramento

Luis E. Aranha Camargo

Dept. Entomologia, Fitopatologia e Zoologia Agrícola

ESALQ/USP

Piracicaba


Da gen mica ao melhoramento

Genômica

Ciência que analisa estrutura, composição e

funcionalidade de genomas


Da gen mica ao melhoramento

Genômica

Sequenciamento

Grande volume de informação

Bioinformática

Análise estrutural

Análise comparativa

Mineração

ou garimpagem

Análise funcional

(várias abordagens: SAGE,

microarranjos, RT-PCR, análise in silico, etc)

Objetivo:Identificar genes e suas funções


Da gen mica ao melhoramento

Genômica

ESTs

seqüências genômicas

bioinformática

genética vegetal

SAGE

proteômica

fenótipo

gene

análise de mutantes

melhoramento vegetal

variação genética

variação fenotípica

Genética x Melhoramento

O melhorista objetiva relacionar variantes de um gene (alelos)com variações

em fenótipos de modo a identificar os melhores alelos


Da gen mica ao melhoramento

Melhoramento genético convencional

seleção

seleção

FENÓTIPO

F = G + A

...

seleção

melhoristas usam uma variedade de estratégias para separar

os efeitos

da variância genética da ambiental


Da gen mica ao melhoramento

Melhoramento convencional

  • se baseia na análise de médias e variâncias para selecionar melhores

  • genótipos

  • pouco se sabe sobre os genes que controlam a característica

  • seleção baseada no somatório dos efeitos dos genes que controlam

  • a característica

Melhoramento assistido por genes candidatos

idéia é associar variações alélicas em certos genes candidatos com variações

em fenótipos

idéia tornou-se palpável a partir do desenvolvimento da Genômica

mas o que são genes candidatos?


Da gen mica ao melhoramento

Resistência a lagarta da espiga (McMullen et al., PNAS 95, 1998)

Efeito maior em maisina

e resistência

Outros locos,

efeito na resistência

mas não em maisina

Efeito menor em maisina e

resistência


Da gen mica ao melhoramento

Projetos ESTs são fontes de genes cadidadtos

TIGR Soybean Gene Index (GmGI)


Da gen mica ao melhoramento

PAL

peroxidades

Lipoxigenase

Genes R

Pr proteínas

Necessidade de conhecimento de vias metabólicas


Da gen mica ao melhoramento

atccctcatttggGatctaggtg

atccctcatttggTatctaggtg

Associação de alelos com fenótipos (análise de ligação)

– cruzamentos experimentais

X

variedade resistente

0% doença

variedade suscetível

60% doença

genes candidatos

genótipos

parentais

em

gene candidatos

palatccctcatttggGatctaggtg atccctcatttggTatctaggtg

loxcggtacacgtttaccagggtcA cggtacacgtttaccagggtcG

pr-1ggcttgacatgcaaatcagga ggcttgacatgcaaatcagga

etc...

Progênie de linhagens recombinantes é classificada de acordo com genótipos

esperados no gene pal

Doença

17%

37%

Presença do alelo G a no locus palestá associada com uma reduçaõ de 54%

na quantidade de doença


Da gen mica ao melhoramento

Problema: a lista de genes candidatos ainda é pequena

pois a maioria das vias metabólicas que controlam características de importância agronômica é incompleta

e aqui é onde a Genômica Funcional entra…

para completar esta vias metabólicas por meio de uma série de técnicas (genética reversa e direta,

análise de expressão gênica via microarranjos, SAGE, e de bancos de EST, etc.)


Sage aguardem

SAGE(aguardem…)


Da gen mica ao melhoramento

Hibridização in silico:auxílio na seleção de marcadores candidatos

Comparações entre bibliotecas de ESTs geradas sob

condições distintas podem servir

de base para identificar marcadores candidatos


Da gen mica ao melhoramento

inoculação

Expressão de genes de resistência

Produtos dos genes estarão

Presentes na amostra de RNAm

Comparar com biblioteca feita de RNAm de planta não inoculada


Da gen mica ao melhoramento

Comparação entre bibliotecas ESTs de feijoeiro geradas de plantas

inoculadas ou não com Colletotrichum

inoculada

não inoc.

Genes candidatos para cruzamentos

experimentais


Da gen mica ao melhoramento

Expressão diferencial com

Auxílio de arranjos

Hibridização em microarranjos

(microarrays)

Permite estudar a expressão de vários genes

de uma só vez

Genes são dispostos em lâminas ou “chips”

(Sanghyeob et al., 2004)

(Gibly et al., 2004)


Da gen mica ao melhoramento

…………

…………

…………

…………

…………

…………

…………

…………

…………

Expressão gênica

diferencial

RNAm de

planta inoculada

cDNA

Síntese de cDNA e marcação com

marcadores fluorescentes

hibridização

cDNA

Microchip

contendo

genes

RNAm de planta

não inoculada


Da gen mica ao melhoramento

Genes somente expressos em

plantas inoculadas

Expressão em ambas situações

Gene somente expresso em

plantas não inoculadas


Da gen mica ao melhoramento

Análise de expressão gênica de indivíduos fenotipicamente distintos - descoberta de genes candidatos

e.g.- análise da expressão gênicade fenótipos extremos de uma população segregante

X

RNAm

RNAm

Diferenças em expressão gênica devem

Ser específicas ao fenótipo e

Genótipo que separam os grupos

Perfil de expressão

Genes candidatos

Schadt et al., Nature 2003, 422:297-302


Da gen mica ao melhoramento

Bioinformática

Genômica x Melhoramento

SNPs

Vias metabólicas

Microarranjos

GENÔMICA

SAGE

EST

Sequenciamento genômico

Análise in silico

MELHORAMENTO

genes candidatos

para análise de ligação em cruzamentos experimentais


Da gen mica ao melhoramento

Obrigado!

Luis E. Aranha Camargo

[email protected]


  • Login