Da Genômica ao Melhoramento - PowerPoint PPT Presentation

Da Genômica ao Melhoramento
1 / 22

  • Uploaded on
  • Presentation posted in: General

Da Genômica ao Melhoramento. Luis E. Aranha Camargo Dept. Entomologia, Fitopatologia e Zoologia Agrícola ESALQ/USP Piracicaba. Genômica. Ciência que analisa estrutura, composição e funcionalidade de genomas. Genômica. Sequenciamento. Grande volume de informação. Bioinformática.

I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.

Download Presentation

Da Genômica ao Melhoramento

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript

Da gen mica ao melhoramento

Da Genômica ao Melhoramento

Luis E. Aranha Camargo

Dept. Entomologia, Fitopatologia e Zoologia Agrícola



Da gen mica ao melhoramento


Ciência que analisa estrutura, composição e

funcionalidade de genomas

Da gen mica ao melhoramento



Grande volume de informação


Análise estrutural

Análise comparativa


ou garimpagem

Análise funcional

(várias abordagens: SAGE,

microarranjos, RT-PCR, análise in silico, etc)

Objetivo:Identificar genes e suas funções

Da gen mica ao melhoramento



seqüências genômicas


genética vegetal





análise de mutantes

melhoramento vegetal

variação genética

variação fenotípica

Genética x Melhoramento

O melhorista objetiva relacionar variantes de um gene (alelos)com variações

em fenótipos de modo a identificar os melhores alelos

Da gen mica ao melhoramento

Melhoramento genético convencional




F = G + A



melhoristas usam uma variedade de estratégias para separar

os efeitos

da variância genética da ambiental

Da gen mica ao melhoramento

Melhoramento convencional

  • se baseia na análise de médias e variâncias para selecionar melhores

  • genótipos

  • pouco se sabe sobre os genes que controlam a característica

  • seleção baseada no somatório dos efeitos dos genes que controlam

  • a característica

Melhoramento assistido por genes candidatos

idéia é associar variações alélicas em certos genes candidatos com variações

em fenótipos

idéia tornou-se palpável a partir do desenvolvimento da Genômica

mas o que são genes candidatos?

Da gen mica ao melhoramento

Resistência a lagarta da espiga (McMullen et al., PNAS 95, 1998)

Efeito maior em maisina

e resistência

Outros locos,

efeito na resistência

mas não em maisina

Efeito menor em maisina e


Da gen mica ao melhoramento

Projetos ESTs são fontes de genes cadidadtos

TIGR Soybean Gene Index (GmGI)

Da gen mica ao melhoramento




Genes R

Pr proteínas

Necessidade de conhecimento de vias metabólicas

Da gen mica ao melhoramento



Associação de alelos com fenótipos (análise de ligação)

– cruzamentos experimentais


variedade resistente

0% doença

variedade suscetível

60% doença

genes candidatos




gene candidatos

palatccctcatttggGatctaggtg atccctcatttggTatctaggtg

loxcggtacacgtttaccagggtcA cggtacacgtttaccagggtcG

pr-1ggcttgacatgcaaatcagga ggcttgacatgcaaatcagga


Progênie de linhagens recombinantes é classificada de acordo com genótipos

esperados no gene pal




Presença do alelo G a no locus palestá associada com uma reduçaõ de 54%

na quantidade de doença

Da gen mica ao melhoramento

Problema: a lista de genes candidatos ainda é pequena

pois a maioria das vias metabólicas que controlam características de importância agronômica é incompleta

e aqui é onde a Genômica Funcional entra…

para completar esta vias metabólicas por meio de uma série de técnicas (genética reversa e direta,

análise de expressão gênica via microarranjos, SAGE, e de bancos de EST, etc.)

Sage aguardem


Da gen mica ao melhoramento

Hibridização in silico:auxílio na seleção de marcadores candidatos

Comparações entre bibliotecas de ESTs geradas sob

condições distintas podem servir

de base para identificar marcadores candidatos

Da gen mica ao melhoramento


Expressão de genes de resistência

Produtos dos genes estarão

Presentes na amostra de RNAm

Comparar com biblioteca feita de RNAm de planta não inoculada

Da gen mica ao melhoramento

Comparação entre bibliotecas ESTs de feijoeiro geradas de plantas

inoculadas ou não com Colletotrichum


não inoc.

Genes candidatos para cruzamentos


Da gen mica ao melhoramento

Expressão diferencial com

Auxílio de arranjos

Hibridização em microarranjos


Permite estudar a expressão de vários genes

de uma só vez

Genes são dispostos em lâminas ou “chips”

(Sanghyeob et al., 2004)

(Gibly et al., 2004)

Da gen mica ao melhoramento










Expressão gênica


RNAm de

planta inoculada


Síntese de cDNA e marcação com

marcadores fluorescentes






RNAm de planta

não inoculada

Da gen mica ao melhoramento

Genes somente expressos em

plantas inoculadas

Expressão em ambas situações

Gene somente expresso em

plantas não inoculadas

Da gen mica ao melhoramento

Análise de expressão gênica de indivíduos fenotipicamente distintos - descoberta de genes candidatos

e.g.- análise da expressão gênicade fenótipos extremos de uma população segregante




Diferenças em expressão gênica devem

Ser específicas ao fenótipo e

Genótipo que separam os grupos

Perfil de expressão

Genes candidatos

Schadt et al., Nature 2003, 422:297-302

Da gen mica ao melhoramento


Genômica x Melhoramento


Vias metabólicas





Sequenciamento genômico

Análise in silico


genes candidatos

para análise de ligação em cruzamentos experimentais

Da gen mica ao melhoramento


Luis E. Aranha Camargo


  • Login