Da Genômica ao Melhoramento
Download
1 / 22

Da Genômica ao Melhoramento - PowerPoint PPT Presentation


  • 95 Views
  • Uploaded on

Da Genômica ao Melhoramento. Luis E. Aranha Camargo Dept. Entomologia, Fitopatologia e Zoologia Agrícola ESALQ/USP Piracicaba. Genômica. Ciência que analisa estrutura, composição e funcionalidade de genomas. Genômica. Sequenciamento. Grande volume de informação. Bioinformática.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Da Genômica ao Melhoramento' - truda


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

Da Genômica ao Melhoramento

Luis E. Aranha Camargo

Dept. Entomologia, Fitopatologia e Zoologia Agrícola

ESALQ/USP

Piracicaba


Genômica

Ciência que analisa estrutura, composição e

funcionalidade de genomas


Genômica

Sequenciamento

Grande volume de informação

Bioinformática

Análise estrutural

Análise comparativa

Mineração

ou garimpagem

Análise funcional

(várias abordagens: SAGE,

microarranjos, RT-PCR, análise in silico, etc)

Objetivo:Identificar genes e suas funções


Genômica

ESTs

seqüências genômicas

bioinformática

genética vegetal

SAGE

proteômica

fenótipo

gene

análise de mutantes

melhoramento vegetal

variação genética

variação fenotípica

Genética x Melhoramento

O melhorista objetiva relacionar variantes de um gene (alelos)com variações

em fenótipos de modo a identificar os melhores alelos


Melhoramento genético convencional

seleção

seleção

FENÓTIPO

F = G + A

...

seleção

melhoristas usam uma variedade de estratégias para separar

os efeitos

da variância genética da ambiental


Melhoramento convencional

  • se baseia na análise de médias e variâncias para selecionar melhores

  • genótipos

  • pouco se sabe sobre os genes que controlam a característica

  • seleção baseada no somatório dos efeitos dos genes que controlam

  • a característica

Melhoramento assistido por genes candidatos

idéia é associar variações alélicas em certos genes candidatos com variações

em fenótipos

idéia tornou-se palpável a partir do desenvolvimento da Genômica

mas o que são genes candidatos?


Resistência a lagarta da espiga (McMullen et al., PNAS 95, 1998)

Efeito maior em maisina

e resistência

Outros locos,

efeito na resistência

mas não em maisina

Efeito menor em maisina e

resistência


Projetos ESTs são fontes de genes cadidadtos 1998)

TIGR Soybean Gene Index (GmGI)


PAL 1998)

peroxidades

Lipoxigenase

Genes R

Pr proteínas

Necessidade de conhecimento de vias metabólicas


atccctcatttgg 1998)Gatctaggtg

atccctcatttggTatctaggtg

Associação de alelos com fenótipos (análise de ligação)

– cruzamentos experimentais

X

variedade resistente

0% doença

variedade suscetível

60% doença

genes candidatos

genótipos

parentais

em

gene candidatos

pal atccctcatttggGatctaggtg atccctcatttggTatctaggtg

lox cggtacacgtttaccagggtcA cggtacacgtttaccagggtcG

pr-1 ggcttgacatgcaaatcagga ggcttgacatgcaaatcagga

etc...

Progênie de linhagens recombinantes é classificada de acordo com genótipos

esperados no gene pal

Doença

17%

37%

Presença do alelo G a no locus palestá associada com uma reduçaõ de 54%

na quantidade de doença


Problema 1998): a lista de genes candidatos ainda é pequena

pois a maioria das vias metabólicas que controlam características de importância agronômica é incompleta

e aqui é onde a Genômica Funcional entra…

para completar esta vias metabólicas por meio de uma série de técnicas (genética reversa e direta,

análise de expressão gênica via microarranjos, SAGE, e de bancos de EST, etc.)


Sage aguardem
SAGE 1998)(aguardem…)


Hibridização 1998)in silico:auxílio na seleção de marcadores candidatos

Comparações entre bibliotecas de ESTs geradas sob

condições distintas podem servir

de base para identificar marcadores candidatos


inoculação 1998)

Expressão de genes de resistência

Produtos dos genes estarão

Presentes na amostra de RNAm

Comparar com biblioteca feita de RNAm de planta não inoculada


Comparação entre bibliotecas ESTs 1998) de feijoeiro geradas de plantas

inoculadas ou não com Colletotrichum

inoculada

não inoc.

Genes candidatos para cruzamentos

experimentais


Expressão diferencial com 1998)

Auxílio de arranjos

Hibridização em microarranjos

(microarrays)

Permite estudar a expressão de vários genes

de uma só vez

Genes são dispostos em lâminas ou “chips”

(Sanghyeob et al., 2004)

(Gibly et al., 2004)


………… 1998)

…………

…………

…………

…………

…………

…………

…………

…………

Expressão gênica

diferencial

RNAm de

planta inoculada

cDNA

Síntese de cDNA e marcação com

marcadores fluorescentes

hibridização

cDNA

Microchip

contendo

genes

RNAm de planta

não inoculada


Genes somente expressos em 1998)

plantas inoculadas

Expressão em ambas situações

Gene somente expresso em

plantas não inoculadas


Análise de expressão gênica de indivíduos fenotipicamente distintos - descoberta de genes candidatos

e.g.- análise da expressão gênicade fenótipos extremos de uma população segregante

X

RNAm

RNAm

Diferenças em expressão gênica devem

Ser específicas ao fenótipo e

Genótipo que separam os grupos

Perfil de expressão

Genes candidatos

Schadt et al., Nature 2003, 422:297-302


Bioinformática fenotipicamente distintos - descoberta de genes candidatos

Genômica x Melhoramento

SNPs

Vias metabólicas

Microarranjos

GENÔMICA

SAGE

EST

Sequenciamento genômico

Análise in silico

MELHORAMENTO

genes candidatos

para análise de ligação em cruzamentos experimentais


Obrigado! fenotipicamente distintos - descoberta de genes candidatos

Luis E. Aranha Camargo

[email protected]


ad