1 / 16

Microarray-Based Assays: Basics of Nucleic Acid Detection and Probe Design

Learn the basics of microarray-based assays, including the use of fluorescently labeled cDNA targets and DNA probes for gene expression analysis. Discover the importance of sequence-specific affinity and thermodynamics in probe design. Explore the process of hybridization and data analysis in microarray experiments.

tolentino
Download Presentation

Microarray-Based Assays: Basics of Nucleic Acid Detection and Probe Design

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Microarray-Based Assays (The Basics) Each feature or “spot” represents a specific expressed gene (mRNA). The fluorescent intensity of each feature correlates with the expression level of the gene (mRNA) in the samples under investigation. From: Duggan et.al. Nature Genetics 21:10-14, 1999

  2. 5’ 3’ C A G T A AC G G T T G T C A T TG C C A A 3’ 5’ Microarray-Based Assays (The Basics) The Key to Nucleic Acid Detection is “Sequence-Specific Affinity” “GC” content (base paring) generally dictates thermodynamics of complementary binding. Tm = Melting Temperature

  3. “TARGET” is the fluorescence labeled cDNA representation of the mRNA and is hybridized to the probe. Microarray-Based Assays (The Basics) “PROBE” is DNA spotted (attached) to the solid substrate (non-fluorescent glass slide).

  4. Biological Samples Microarray Hybridization Microarray Imaging Microarray Raw Data Analysis Microarray Statistical Data Analysis Microarray Production 384-well plate

  5. Microarray Oligonucleotide Probe Design System • Experimental Assessment of DNA Binding Behavior • Design and Implementation

  6. Assessment of Sequence-Specific Cross-Reactivity/Cross-Hybridization Microarray Oligonucleotide Probes Mismatched Base Pairs 1) AGCCCGATGATGAGCGACTCACCACGGGCCACGGCTTCTGACTCTCTTT 0 2) AGCCCGATGATGAGCGACTCACCAGGGGCCACGGCTTCTGACTCTCTTT 1 3) AGCCCGATGATGAGCCACTCACCACGGGCCAGGGCTTCTGACTCTCTTT 2 4) AGCCCGATGATCAGCGACTCACCTCGGGCCACGGCATCTGACTCTCTTT 3 5) AGCCCCATGATCAGCGAGTCACCTCGGGCCACGCCTTCTGACTCTCTTT 5 Normalized Target/Probe 32C 42C 52C Microarray Oligonucleotide Probes Kane, MD et. al. Gene Cloning and Expression Technologies (2002) Ch. 35:537-547

  7. Assessment of Sequence-Specific Cross-Reactivity/Cross-Hybridization A. Yick_337 Yick_884 Yick_GAP Yeio_997 Yeio_469 Yeio_GAP Yabm_392 Yabm_552 Yabm_GAP B. yicK cDNA yeiO cDNA yabM cDNA Kane, MD et. al. Nucleic Acids Res. (2000) 28:4552-4557

  8. 14 Nucleotides; 6 (42%) GC 8 Nucleotides; 6 (75%) GC Assessment of Sequence-Specific Cross-Reactivity/Cross-Hybridization A. 80% Overall Homology (Cross-hybridization detected); Yick_337 gcgtacttctgagtagttttgcttccaccgcaaacccgcaaatgttcgcc |||| |||| || || |||| || ||||| |||||||||||||| ||| yeiO 335 gcgtctttcttagcagctttggctcgaccgctaacccgcaaatgtttgcc 74% Overall Homology (No cross-hybridization detected); yicK 471 gttatcgggccaccgctcgcttatgaactggcaatgggatttagttttaa || || || |||||||| ||||||| | || ||||| || || |||| Yeio_469 gtcattggcccaccgctggcttatgccttagcgatgggtttcagctttac B. Kane, MD et. al. Nucleic Acids Res. (2000) 28:4552-4557

  9. Microarray Oligonucleotide Probe Design System • Experimental Assessment of DNA Binding Behavior • Design and Implementation

  10. Remove Redundant Entries Confirm RNA vs. Genomic DNA Confirm Species Selection on Each Gene Identify Longest mRNA Identify Splice/Isoform Variants (Segments) Contigs Used to Increase EST Sequence Quality Microarray Oligonucleotide Probe Design System Objective: Computationally Design Gene-Specific Microarray Probes Commercial Objective: Produce and Sell Pre-Printed Oligo-Probe Microarrays Data Flow Target Gene List Obtain Sequence Info Sequence QC Genomic Sequence Database

  11. Microarray Oligonucleotide Probe Design System Target Gene List Probe Design Obtain Sequence Info Sequence QC Genomic Sequence Database Oligonucleotide Probe Length = 46-54 bases AGAAGAAGCCGATGATGACGAGGACGATGAGGATGGTGATGAGGTAGAGGAAGAGGCTGAGGAACCCTAC…

  12. AGAGCACGCGGAGGAGCGTGCGCGGGGGCCCCGGGAGACGGCGGCGGTGGCGGCGCGGGCAGAGCAAGGA… 82.6% GC (failure) >4 cont. G or C (failure) 46 bases 46 bases 54.3% GC AGAAGAAGCCGATGATGACGAGGACGATGAGGATGGTGATGAGGTAGAGGAAGAGGCTGAGGAACCCTAC… Microarray Oligonucleotide Probe Design System • Accept if GC content range = 40%-60% • Reject 4 or more contiguous bases of G or C (2ndary Structure) • Reject palindromic-hairpin sequences greater than 7 bases (2ndary Structure) • Reject known splice site sequences • Accepted if Calculated Tm = 52.4 C ± 4.0 C • No more than 75% homology within the target region of non-target genes. • No more than 14 contiguous base pairs with non-target genes. Target Gene List Primary Probe Evaluation Obtain Sequence Info Sequence QC Probe Design Genomic Sequence Database

  13. Microarray Oligonucleotide Probe Design System • Accept if GC content range = 40%-60% • Reject 4 or more contiguous bases of G or C (2ndary Structure) • Reject palindromic-hairpin sequences greater than 7 bases (2ndary Structure) • Reject known splice site sequences • Accept if Calculated Tm = 52.4 C ± 4.0 C • No more than 75% homology within the target region of non-target genes. • No more than 14 contiguous base pairs with non-target genes. Target Gene List Basic Local Alignment Search Tool (BLAST) against published sequences in target species. Parse BLAST Output Accept/Reject Candidate Probe Secondary Probe Evaluation Obtain Sequence Info Sequence QC Probe Design Primary Probe Eval Genomic Sequence Database

  14. Microarray Oligonucleotide Probe Design System Obtain Sequence Info Target Gene List Genomic Sequence Database GC Rich/Poor 2ndary Structure Known Splice Site Primary Probe Evaluation Sequence QC Probe Design Secondary Probe Evaluation High Quality mRNA DNA Sequences Redundant Entries Wrong Species Rank Acceptable Probes Cross-Hybridization Potential Optimal Probes: Nearest to Desired Tm Probe Annotated: GInumber_start_length

  15. Microarray Oligonucleotide Probe Design System Target Gene List Obtain Sequence Info Sequence QC Probe Design Primary Probe Evaluation Secondary Probe Evaluation Rank Acceptable Probes Genomic Sequence Database SYSTEM PERFORMANCE X  50 genes/hour generating 2 probes for each target gene (mRNA). Dedicated PC 1 ghz 1 gig RAM Desk Top PC 500 mhz 512 meg RAM File-Based Communication

  16. Synthesis Purification Oligonucleotide Probes Design Number of Spots Spot Size Replicates Solid Substrate (slide) Functional Surface Chemistry DNA Probes MICROARRAY SPOTTER cDNA (PCR) Probes Amplification Purification Clones Record File (.gal file) DNA Microarrays Processing Chemistry Control Sample RNA Isolation RT (Fluorescence) Labeling Storage Delivery Sample Test Sample Pre-Hybridization Chemistry HYBRIDIZATION Time, Temp, Buffers, Wash STUDY DESIGN and OBJECTIVES IMAGING Resolution, Region of Interest Raw Data Image (.tif file) Raw Data Analysis Spot Finding, Background Subtraction, Signal Intensity, Normalization Gene Specific Data Biological/Bioinformatics Analysis

More Related