Transcripci n
This presentation is the property of its rightful owner.
Sponsored Links
1 / 61

Transcripción PowerPoint PPT Presentation


  • 64 Views
  • Uploaded on
  • Presentation posted in: General

Transcripción.

Download Presentation

Transcripción

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Transcripci n

Transcripción

Para que la información genética almacenada en el DNA sea utilizada por los organismos se requiere que sean sintetizadas cadenas de RNA complementarias al DNA por medio de un proceso conocido como transcripción (de “scribere”=escribir y “trans”= pasar de uno a otro, en este caso de una escritura a otra).


Transcripci n1

Transcripción

  • Fue adoptado por la evolución para tener un mensajero capaz de llevar la información almacenada en el DNA de forma parcializada, ordenada y regulada.

  • El resultado de la transcripción es una molécula de RNA llamada transcrito.


Transcritos

Transcritos

  • Cuando sirve como patrón para la síntesis de proteínas se conoce como RNA mensajero o RNAm;

  • Cuando constituye parte de la estructura de los ribosomas, como RNA ribosomal o RNAr;

  • Cuando participa en la síntesis de proteínas como adaptador de los aminoácidos, como RNA de transferencia o RNAt; o

  • Puede tener varias otras actividades como

    • enzimáticas, ribozima

    • o actividades de regulación de la expresión genética, RNA de interferencia o RNAi.


Transcripci n y superenrollamiento

Transcripción y Superenrollamiento

(a)

RNA polimerasa

Burbuja de Transcripción

Enrollamiento

Desenrollamiento

5'

3'

5'

3'

3'

5'

Híbrido RNA-DNA

RNA

Dirección de la trancripción

Superhélices

positivas

(b)

Superhélices

negativas

Dirección de la trancripción

5'


Localizaci n de transcritos

Localización de transcritos

Transcritos de RNA

DNA

36 x 103 pb

  • Genoma de adenovirus, ambas hebras contienen codificación de proteínas. Muchos de los mensajeros se sintetizan inicialmente en forma de un transcrito largo que proviene de dos tercios de la longitud del DNA. Este transcrito es modificado posteriormente.


Nomenclatura de las hebras de dna en la transcripci n

Hebra molde

Hebra menos (-)

Hebra codante

Hebra no molde

Hebra más (+)

Hebra no codante

Nomenclatura de las hebras de DNA en la transcripción


Ejemplo de complementariedad

Ejemplo de complementariedad

(5')CGCTATAGCTGTTT(3')

Hebra de DNA no molde (+)

(3')GCGATATCGACAAA(5')

Hebra de DNA molde (-)

(5')CGCUAUAGCUGUUU(3')

Transcrito de RNA


Rna polimerasa

RNA polimerasa

Subunidad s

Núcleo de la

enzima


Promotores en e coli resumen

Región -35

Espaciador

Región -10

Espaciador

Inicio del RNA

Promotores en E. coli. Resumen

trp

TTGACA

N17

TTAACT

N7

A

TTTACA

N16

TATGAT

N7

A

tRNATyr

lac

TTTACA

N17

TATGTT

N6

A

recA

TTGATA

N16

TATAAT

N7

A

araB, A, D

CTGACG

N18

TACTGT

N6

A

TTGACA

TATAAT


Promotores de e coli 1

Promotores de E. coli. 1


Inhibidores de la transcripci n

+

N

H

Sar

Sar

L-Pro

L-Pro

L-meVal

L-meVal

D-Val

O

D-Val

O

L-Thr

L-Thr

O

C

O

C

N

NH2

O

O

CH3

CH3

Inhibidores de la transcripción

Acridina

Actinomicina D


Terminaci n de la transcripci n

Terminación de la transcripción

  • Una vez que el proceso de transcripción ha comenzado la burbuja de transcripción avanza a medida que el RNA es transcrito y se continúa hasta que la polimerasa encuentra una secuencia que induce la disociación del complejo DNA-RNA y la separación de la enzima.

  • En eucariontes esta secuencia no ha sido bien estudiada, mientras que para los procariontes como E. coli se han reconocido dos tipos de señales de terminación que se diferencian por la ausencia o presencia de un factor proteico que parece reconocer dicha señal.


Terminaci n rho independiente

Terminación rho independiente

  • Terminación independiente de rho (r), contiene una secuencia que induce a la formación de una horquilla en el transcrito de RNA de 10 a 15 nucleótidos antes del final, seguida por un tramo de poliA en la cadena molde que facilita la disociación de los elementos de la transcripción.


Transcripci n

  • En la terminación dependiente de r no se presenta el tramo de poliA, aunque sí se forma una horquilla en la que la RNA polimerasa hace una pausa y si se encuentra la proteína r presente se detiene la transcripción.

  • No se conoce a detalle el mecanismo de disociación, pero en este se produce la hidrólisis de ATP por efecto de r.


Regulaci n de la transcripci n en procariontes

Regulación de la transcripción en procariontes.

  • Muchas proteínas bacterias son inducibles

    • su síntesis es regulada dependiendo del estado nutricional de la célula.

  • La expresión diferencial de los genes que codifican para esas proteínas esta regulada generalmente a nivel de la iniciación de la transcripción


Regulaci n 2

Regulación 2

  • Basados en el modelo de Jacob y Monod del control transcripcional, la transcripción del operón lac, que codifica 3 proteínas inducibles, es reprimido por unión de la proteína represora de lac a la secuencia operadora.

  • En presencia de lactosa o otros inductores, esta represión se levanta y el operón lac se transcribe.


Regulaci n 3

Regulación 3

  • Las mutaciones en el promotor, que une a la RNA polimerasa, o en el operador, actúan en cis; esto es sólo afectan la expresión de los genes en la misma molécula de DNA en que ocurre la mutación.


Regulaci n 4

Regulación 4

  • Las mutaciones en la secuencia de un operador que resulta en la disminución de la unión del represor, resultan en una transcripción constitutiva.

  • Las mutaciones en una secuencia promotora, que afectan la afinidad de la unión de la RNA polimerasa pueden disminuir (mutación a la baja) o incrementar (mutación a la alta) la transcripción.


Regulaci n 5

Regulación 5

  • Los represores y los activadores actúan en trans; esto es, afectan a la expresión de los genes que regulan sin importar en qué molécula de DNA están localizados en la célula.


Las mutaciones oc del oper n lac act an en cis

Las mutaciones Oc del Operón lac actúan en cis


Acci n trans del oper n lac

Acción trans del Operón lac


El inductor produce incremento en la transcripci n del oper n

El inductor produce incremento en la transcripción del operón.


X gal

X-Gal

  • 5-bromo-4-chloro-3-indolyl-b-D-galactoside


Regulaci n negativa en la transcripci n

(a) La molécula señal

( ) origina la disociación

de la proteína reguladora

del DNA

(b) La molécula señal

( ) origina la unión

de la proteína reguladora

al DNA

Regulación negativa en la transcripción

Operador

DNA

Promotor

3'

5'

mRNA

3'

5'

mRNA


Regulaci n positiva en la transcripci n

(a) La molécula señal

( ) origina la disociación

de la proteína reguladora

del DNA

(b) La molécula señal

( ) origina la unión

de la proteína reguladora

al DNA

Regulación positiva en la transcripción

RNA polimerasa

3'

5'

mRNA

3'

5'

mRNA


Modelo general de oper n

Modelo general de operón

Sitio de unión

del represor

(operador)

Sitio de unión

del activador

Promotor

DNA

A

B

C

Secuencias reguladoras


Oper n lac reprimido

Y

A

PI

I

P

O

Z

Operón lac reprimido

Represor

mRNA


Inducci n del oper n lac

Y

A

PI

I

P

O

Z

Y

A

PI

I

P

O

Z

Inducción del operón lac

DNA

Alolactosa

(o IPTG)

mRNA


Control positivo de la transcripci n

Control positivo de la transcripción

  • Una proteína reguladora promueve la unión de la RNA polimerasa, de manera que se incrementa la síntesis del mRNA.


Activaci n de la transcripci n del oper n lac

Activación de la transcripción del operón lac

Sitio CAP

5'-ATTAATGTGAGTTAGCTCACTCATTAGGCACCCCA

Región -10

Región -35

GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTG

Sitio de unión a la RNA polimerasa

Operador

GAATTGTGAGCGTGATAACAATTTCACAC


Estructura tridimensional del homod mero cap

Estructura tridimensional del homodímero CAP

Motivo de unión al DNA

DNA

cAMP


Efectos combinados de glucosa y lactosa en la expresi n del oper n lac

P

O

P

O

P

O

P

O

Efectos combinados de glucosa y lactosa en la expresión del operón lac

Deficiencia de lactosa

Abundancia de lactosa

Deficiencia

de glucosa,

abundancia

de cAMP

RNA polimerasa

mRNA

Abundancia

de glucosa,

deficiencia

de cAMP


Oper n ara

Operón ara

Activador

L-Arabinosa

Represor

araC mRNA

Sitio de unión de CAP

araO2

araO1

araI

Genes estructurales

araC

araB

araA

araD

PC

PBAD

araBAD mRNA

Sitios de Regulación


Regulaci n del oper n ara 1

Regulación del operón ara (1)

Sitio de unión de CAP

RNA

polimerasa

araO2

araI

araC

araBAD

PBAD

araO1

PC

araC mRNA


Regulaci n del oper n ara 2

Regulación del operón ara (2)

Glucosa a niveles altos

arabinosa a niveles bajos

araO2

Proteínas

AraC

araC

araO1

araBAD

PBAD

araI

PC

Sitio de unión de CAP


Regulaci n del oper n ara 3

Regulación del operón ara (3)

Glucosa a niveles bajos

arabinosa a niveles altos

CAP-cAMP

RNA

polimerasa

Proteína AraC

araC

araBAD

araO2

PBAD

araI

PC

araBAD mRNA

arabinosa


Oper n de triptofano

Operón de triptofano

Trp

Represor

Trp

Represor

mRNA

Guía (trpL)

Atenuador

trpB

trpA

trpD

trpC

trpR

O

trpE

P

Genes estructurales

Región reguladora

trp mRNA

bajos niveles

de triptofano

mRNA

atenuado

altos niveles de triptofano


Regulaci n del oper n trp

Regulación del operón trp

Estructura

atenuadora

MKAIFVLKGWWRTS

Péptido

líder

RNA

polimerasa

Ribosoma

4

3

1

2

5'

UUU 3'

mRNA

DNA

Codones Trp

Péptido

líder

MKAIFVLKG

Genes estructurales

2

3

4

1

RNA

polimerasa

DNA


Secuencia gu a de trp l

Secuencia guía de trpL

Péptido guía

M K A I F V L K G W W R T S - PARO

1

2

3

4

Polipéptido

TrpE


Apareamiento del atenuador

Apareamiento del atenuador

Par 3:4

Par 2:3


Otros mecanismos de atenuaci n

Otros mecanismos de atenuación

  • Las Bacteria Gram positivas (B. subtilis) utilizan la atenuación.

  • El mecanismo es independiente de la traducción.

  • Utiliza una proteína que se une al RNA cuando existe un efector.

  • El efector puede ser el aminoácido regulado pero también su aminoacil-tRNA.

  • La proteína se llama proteína trp de atenuación (en el caso del triptofano).


Otros sistemas de atenuaci n

Otros sistemas de atenuación

  • Operones de la biosíntesis de pirimidinas (E. coli traduccional y B. subtilis con proteína de atenuación).

  • Atenuación traduccional. La traducción del péptido líder previene la traducción del siguiente gen en un mensajero policistrónico.

  • Genes de resistencia a antibióticos en Gram positivas.


Otras redes de control global

Otras redes de control global

  • Sistemas que regulan muchos genes simultáneamente en respuesta a una señal ambiental específica.

  • Los sistemas de control global pueden incluir más de un regulón.

  • Modulón es un grupo de genes que pueden responder a una proteína reguladora común incluso cuando son de diferentes regulones.

  • Estimulón es un grupo de genes que responden a la misma señal ambiental


Factores sigma alternativos

Factores sigma alternativos

  • Factor sigma es la subunidad de la RNA polimerasa que reconoce al promotor.

  • La mayoría de genes de E. coli responden a s70.

  • La cantidad del factor sigma alternativo regula la respuesta del E. coli sistema global.

  • En E. coli hay 7 factores s diferentes.

  • B. subtilis tiene un factor s más.


Algunos sistemas de control global por factor s en escherichia coli

Algunos sistemas de control global por factor s en Escherichia coli.


Quorum sensing percepci n e quorum

Quorum sensing (percepción e quorum)

  • Señal regulatoria controlada por la densidad de población.

  • Cada bacteria sintetiza una lactona de homoserina acilada (AHL).

  • La AHL difunde hacia el exterior de la célula sin problema.

  • Se alcanza un concentración intracelular alta de AHL cuando hay alta densidad celular.

  • AHL se une a una proteína activadora y enciende genes.

  • Sistema luciferasa bacteriana, genes de producción de biofilms (películas) en P. aeruginosa, en Staphylococcus aureus produce varias proteínas virulentas.


Transducci n de se ales y sistemas reguladores de dos componentes

Transducción de señales y sistemas reguladores de dos componentes

  • La señal externa no es transmitida directamente a la proteína reguladora.

  • La señal es detectada primero por un sensor

  • La señal se transmite en una forma diferente hacia el sistema regulador en un proceso llamado transducción de señales.


Componentes del sistema regulador

Componentes del sistema regulador

  • Proteína detectora específica localizada en la membrana. Generalmente una quinasa detectora.

  • Proteína reguladora de respuesta específica.


Quinasa detectora

Quinasa detectora

  • Enzima de membrana plamática que Fosforila compuestos

  • Detecta la señal ambiental en la superficie externa y se fosforila a sí misma en un residuo de histidina

  • Este fosfato se transmite a el regulador de respuesta intracelular.

  • El regulador de respuesta intracelular es una proteína que controla la trascripción uniéndose al DNA.


Sistemas reguladores de dos componentes en la regulaci n de la transcripci n de e coli

Sistemas reguladores de dos componentes en la regulación de la transcripción de E. coli


Quimioaxis

Quimioaxis

  • Movimiento de acercamiento o alejamiento bacteriano de un compuesto químico particular

  • No es una respuesta a gradientes espaciales de una sustancia sino gradientes temporales

    • Sienten el cambio en concentración de un compuesto fuera de la célula a intervalos

  • Sistema de dos componentes para sentir este cambio y regulan el movimiento flagelar.


Prote nas involucradas en quimiotaxis

Proteínas involucradas en quimiotaxis

  • Proteínas sensoras: Aceptoras de grupos metilo (MCPs)

  • En E. coli se han identificado cinco MCPs

  • Todas son transmemebranales

  • Las MCPs se unen directamente a un compuesto o indirectamente a una proteína periplasmática

  • Se disparan una serie de reacciones que afectan la rotación del flagelo.

    • Rotación antihorario, la célula continua, rotación horario, la bacteria da un viraje.


Quimiot xis en e coli

Quimiotáxis en E. coli

  • CheW y CheA proteínas citoplásmicas,


Transcripci n

  • La mayoría de sistemas de regulación controlan la transcripción mediante proteínas reguladoras.

  • Existen RNAs reguladores (antisentido)


Acoplamiento entre trascripci n y traducci n

Acoplamiento entre trascripción y traducción

RNA polimerasa

DNA duplex

5'

3'

3'

5'

mRNA

Ribosoma

Dirección de transcripción

5'

mRNA

NH3+

NH3+

Dirección de traducción


Elementos reguladores lejanos en operones bacterianos

Elementos reguladores lejanos en operones bacterianos


Resumen de la transcripci n

Resumen de la transcripción


Splicing del gen de ovoalb mina

L

1

2

3

4

5

6

7

A

B

C

D

E

F

G

Splicing del gen de ovoalbúmina

Gen de Ovoalbúmina

DNA

L

1

2

3

4

5

6

7

Transcrito

primario

A

B

C

D

E

F

G

Edición, rompimiento

y poliadenilación

Cap

RNA extra

7 intrones

1

2

3

4

5

6

7

AAAAn

RNA maduro

1.872

nucleótidos


Inicio

Inicio


  • Login