,
This presentation is the property of its rightful owner.
Sponsored Links
1 / 14

Цепи, концы и направления PowerPoint PPT Presentation


  • 109 Views
  • Uploaded on
  • Presentation posted in: General

Цепи, концы и направления. Одноцепочечная ДНК. 5 ’. 5 ’. Цепи, концы и направления. 5 ’. 3 ’. 3 ’. 5 ’. Ген. Белок. N. C. Какая цепь кодирующая ?. 3 ’. ДНК. РНК-полимераза. Рибосома. РНК. 5 ’. Сопряжение процессов транскрипции и трансляции у прокариот. Белок. N.

Download Presentation

Цепи, концы и направления

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


,

5

5


,

5

3

3

5

N

C

?


3

-

5

N


-

1 -

-


5

-

-

-


AAAAA

AAAAA

5

5

3

3

TTTTT

TTTTT

3

3

5

5

-

3OH

-

-

?

S1


5

3

C

D

A

B

A

B

C

D

A

B

C

D

5

3

C

D

A

B


(PCR).


AAAAAA

CCCCCC

5


PCR

?


1. .


2.

?

GGGGAGGGTCGCGCGGG-ACGGCCTGGC

TCAT+CA+G+AATG+AA-++T+AT++A+

CT+++CA+G++GTG+AA-++TA++AA++

CT+++CA+G++GTG+AA-++TA++AA++

CT+++CA+G++GTG+AA-++TA++AA++

CT+++CA+G++GTG+AA-++TA++AA++

CT+++CA+G++GTG+AA-++TA++AA++

TT+++CC+G+ATTG+A+T++TCA+GA++

TT++TCC+G+AGT++A+T++TTTT+AA+

TT++TCC+G+AGT++A+T++TTTT+AA+

CT+AGTC+G+AGTA+AA-++TAATGA++

TCCCGGTGTAGCGGTGAAATGCGTAGAGATCGGGAG

+++A+++++++++++++++++++++++T+++T+++A

+T++++++G+++++++++++++A+T++++++++A+A

+T++++++G+++++++++++++A+T++++++++A+A

+T++++++G++++++++++++++++++++++++A+A

+T++++++G++++++++++++++++++++++++A+A

+++AT+++G+++++++++++++++++++++AT++++

C++TA+C+++A+A++++++++T+++++TT+TA++GA

C++TA+C+++A+A++++++++T+++++TT+TA++GA

+++G+++++++++++++++++++++++++++++++A

+++AC+++++++++++++++++++++++++GT++++


Apr

LacZ

Ori


  • Login