Skip this Video
Download Presentation
Missed topic – lateral flow immunochromatography assays Common format for home tests (e.g. HCG - pregnancy) and now many medical lab tests

Loading in 2 Seconds...

play fullscreen
1 / 31

Missed topic – lateral flow immunochromatography assays Common format for home tests (e.g. HCG - pregnancy) and now - PowerPoint PPT Presentation

  • Uploaded on

Missed topic – lateral flow immunochromatography assays Common format for home tests (e.g. HCG - pregnancy) and now many medical lab tests. Questions – how many gold particles at what density for easily visible line? why are they visible – details of surface

I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
Download Presentation

PowerPoint Slideshow about ' Missed topic – lateral flow immunochromatography assays Common format for home tests (e.g. HCG - pregnancy) and now ' - thai

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

Missed topic – lateral flow immunochromatography assays

Common format for home tests (e.g. HCG - pregnancy)

and now many medical lab tests


Questions –

how many gold particles

at what density for

easily visible line?

why are they visible –

details of surface

plasmon resonance,

effect of particle size

how many patents, who

owns them?

issues re: home testing,

FDA approval


Intro to DNA, RNA for engineers

Main Points

How to copy, cut, paste (rearrange) pieces of DNA

Make RNA from DNA and vice versa

Some engineering applications of nucleic acids

capturing/detecting other molecules

bind complementary DNAs, RNAs

bind other small molecules

e.g. carbon nanotubes (!)

constructing novel, nano-scale structures



Base pairing –

at edges –

holds strands


Base stacking –

above & below -


ds into helix

Boiling separates







RNA – like DNA, except OH at 2’ position, and Uridine for Thymine













Cut at P -> one

3’ and one 5’ end; usually P

stays at 5’ end









Watson-Crick base pairs

G-C 3 hydrogen bonds

A-T 2 hydrogen bonds

weaker than G-C


(2 rings) (1 ring)


Practical consequences of double helix structure

DNA replication method based on separating strands,

assembling new copy on single-stranded template via

base pairing and ligating new bases to growing chain

engineering application – pol. chain rxn. (pcr)

Sequence-specific binding between strands

with complementary sequence – many applications!

dsDNA is stiffer than ssDNA – applications in single-

molecule sensing methods using DNA tethers

Nature has evolved variety of enzymes that unwind, cut,

religate, repair DNA = energy-consuming nanomachines


Enzymes that act on DNA or RNA, useful to engineer

pieces of DNA with desired sequence

1. DNA polymeraseN

strands are


adds bases

to 3’-end

pol requires primer to start synthesis




Short pieces of DNA (“oligo”nucleotides~1-100 bases)

can be chemically synthesizedN, commercially available

for ~$1/base for 100nmol = 6x1016 molecules

Can be modified by attaching biotin, fluors, other small

chemical labels – useful as capture molecules,

hybridization probes, as primers to initiate copying

at specific starting point on template DNA strand

-> method for exponential synthesis of segment of DNA

= polymerase chain reaction or pcrN


Pcr amplification of DNA using thermostable DNA

polymerase (e.g. Taqpol)

copy strand (B)





strand (A)

Melt DNA (94oC), cool (60oC) to anneal primers, extend (72oC)

new strand A

reverse primer


Old and new templates are not destroyed by melting,

so repeated cycles of melting and polymerization ->

1 -> 2 -> 4 -> 8 -> … -> 2n copies of DNA region lying

between 2 primer-annealing sites on initial template

Polymerase copies ~1000b/min =>

~1 hour for 230 =1010-fold amp. of a kb piece of DNA


Portion of sequence of lambda phage DNA

convention: seq reads 5’->3’,

seq of only one strand of dsDNA is shown

1 gggcggcgacctcgcgggttttcgctatttatgaaaattttccggtttaaggcgtttccg 61

ttcttcttcgtcataacttaatgtttttatttaaaataccctctgaaaagaaaggaaacg 121

acaggtgctgaaagcgaggctttttggcctctgtcgtttcctttctctgtttttgtccgt 181

ggaatgaacaatggaagtcaacaaaaagcagctggctgacattttcggtgcgagtatccg 241

taccattcagaactggcaggaacagggaatgcccgttctgcgaggcggtggcaagggtaa 301

Could you write sequence of opposite strand?

Could you specify sequence of two 20 base primers to

amplify segment consisting of bases 11-290?

one primer must hybridize to sequence shown and

be extended 5’->3’; other primer must hybridize to

complement of sequence shown


2. Reverse transcriptase is enzyme related to DNA pol that

makes a DNA copy using ssRNA (or ssDNA) as template

Useful for making (DNA) copies of RNA, then amplifying

by pcr for detection or analysis

RNA = chemical cousin of DNA, has extra OH at position 2

on sugar backbone and base U instead of T

In living things, DNA is copied to RNA (transcription, by

RNA polymerase) and RNA sequence “translated” into

amino acid sequence in proteins by large complex of

protein and RNA (ribosome); these rxns can now be

carried out in vitro to make artificial proteins starting

with DNA of arbitrary sequence


3. Restriction EnzymesN– useful for “cutting and pasting”

DNAs to rearrange segments, make new DNA

molecules from preexisting DNA pieces

Cut DNA backbone at

specific short sequence;

may leave ss overhang

that can be used to direct

assembly of DNA pieces

with complementary


EcoRI 5’--GAATTC--


NheI 5’--GCTAGC--


AvrII 5’--CCTAGG--



Map of enzymes that cut this

circular DNA once

What size piece(s)

does cutting with

EcoRI produce?

Cutting with

EcoRI + PstI?

Cutting with

SpeI + SacI?


Sizing DNA fragments by agarose gel electrophoresis

Load DNA + fluor. dye that binds DNA

run ~100V x 30min

Illuminate gel with uv light

D, known size DNAs:

Why does DNA run from – to +?

Why do smaller fragments run faster?


Given lane D results,

which of the maps

(A, B, or C) indicates

HindIII sites?


Some RE’s are homodimers,

cut palindromes

Some are heterodimers,

cut non-palindromes

Mutations in one member

of heterodimer can ->

enzyme that cuts only

one strand (“nicking”)

Putting 2 nicking sites near

one another allows you

to create ss “gap” in dsDNA (nick and melt off ---------)

gap potentially useful as capture molecule









4. Ligases

reform phosphodiester bonds – join pieces of DNA

reverse effects of restriction enzymes

may be guided by annealing of complementary overhangs

fragments A fragments B

GATC--atc--- + GATC-gcc--

--tag---CTAG -cgg--TTAA

note multiple possible ligation products:

AA, A , AB, B, AAA…, A , gatcBBttaa,…

Can you get BA, BBB?






Cloning plasmid DNA in bacteria

Small circular DNAs (plasmids) grow inside bacteria

Plasmids can encode antibiotic resistance genes (e.g. ampr)

Engineer plasmid DNA (e.g. cut with EcoRI, ligate in

fragment with gene of interest, “transform”

E Coli, select those that grow on plates w/ ampicillin,

isolate plasmid DNA from individual bacterial colonies

digest with EcoRI to see if DNA contains EcoRI insert)

Note: need Eco RI not to cut gene of interest

have to rely on chance location of restr. sites


Note some ligated fragments can be recut:

EcoRI (GAATTC) EcoRI product restores EcoRI site

5’--G AATTC-- 3’ 5’--GAATTC--

3’--CTTAA G-- 5’ 3’--CTTAAG--

Others cannot:

NheI (GCTAGC) AvrII (CCTAGG) product = NheI or AvrII


5’--G CTAGG--3’ 5’--GCTAGG--

3’--CGATC C--5’ 3’--CGATCC—

Can be useful to ligate pieces into plasmid, then recut to

linearize/inactivate plasmid that has religated without insert



pcr has partially replaced restriction enzymes as

construction tool to genetically engineer DNA

because it allows joining pieces of DNA at arbitrary

positions, independent of fortuitous position of

restriction sites

Method uses “strand overlap extension”


Put small piece of dna 2 sequence

at 5’ end of pcr primer for dna1

Strand overlap extension

first pcr product




template 1






bottom strand of product

can anneal to DNA 2

to generate extension

product that can be

amplified with primers

C and B to generate fusion

product of DNA 1 and 2

with arbitrary junction,

independent of restriction enz.


template 2


Circular permutation trick to allow pcr amplification

of region of unknown sequence outside of region

of known sequence





pcr with 1 and 2




“Nested” pcr provides single-template molecule sensitivity

first pcr takes 1 molecule -> ~108

second pcr takes ~108 molecules -> ~1012 molecules

by changing primers one avoids primer-dimer artifact


7. RNA polymeraseN – partially melts dsDNA template

and makes ssRNA copy

Some RNA pol’s can use

ssDNA as template

Useful to make RNA copies of DNA

engineering application:

ssRNAs can fold into non-

uniform shapes that bind small

molecules (then called aptamers),

sometimes used instead of Abs


Ribosome (protein-RNA complex) “reads” ssRNA

sequence 3 bases at a time and assembles protein,

amino acid by amino acid

amino acid 1

amino acid 2

amino acid 3

triplet genetic codeN


Central Biological Dogma: DNA <--> RNA -> protein

DNA pol, pcr


The enzymes involved act

as nanoscale motors

walking along templates

RNA pol




DNA can be engineered – cut, copied, exponentially

amplified, joined to other pieces, sequenced

(next few weeks) with single base precision

Methods take advantage of enzymes that perform

component steps in living organisms

Details of how these enzymes work as nanomachines

is focus of current research, especially using

methods that report on single-molecules


DNA is remarkable as polymer with variable sequence

applications take advantage of properties

that are function of adjustable length

nanoscale tethers with well characterized

linear and torsional spring constants

variety of nanostructures – rings, multi-walled

tubes, switches, emoticons (!)

and properties that are function of sequence

binding to complementary sequences

binding to other molecules and nanostructures

ability to make vast libraries of diff. seq.

& select for ones with desired prop.

diagnostic and therapeutic medical uses
