1 / 29

Sequences and their Properties

Sequences and their Properties. Nucleotides. DNA A, T, G, C RNA A, U, G, C. Writing sequences. Written 5’-3’ ATGGGTAGCGGTCATGATAC Complement TACCCATCGCCAGTACTATG Reverse (inverse) CATAGTACTGGCGATGGGTA Reverse complement GTATCATGACCGCTACCCAT. Annealing.

thaddeus-hays
Download Presentation

Sequences and their Properties

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Sequences and their Properties

  2. Nucleotides • DNA • A, T, G, C • RNA • A, U, G, C

  3. Writing sequences • Written 5’-3’ • ATGGGTAGCGGTCATGATAC • Complement • TACCCATCGCCAGTACTATG • Reverse (inverse) • CATAGTACTGGCGATGGGTA • Reverse complement • GTATCATGACCGCTACCCAT

  4. Annealing • Nucleic acids can base pair with their reverse complement sequence • Two opposing forces affect annealing • Hydrogen bonds favours annealing • Phosphate groups favours denaturation

  5. Annealing-Melting Point (Tm) • The Tm is the temperature at which 50% of the nucleic acid molecules are in a single stranded state (or double stranded) • The Tm is a function of: • Percentage G:C • Ionic composition of the environment • The percentage of complementarity • Estimate of Tm • =2(#A:T) + 4(#G:C)

  6. (38%) G+C (52%) 0 50 100 (58%) (66%) 70 80 90 100 Tm Vs percentage G:C % Double stranded Temperature (C)

  7. (0.1M NaCl) (0.2M NaCl) (0.5M NaCl) 70 80 90 100 Tm Vs Conc. of Positive Ions 0 50 100 % Double stranded Temperature (C)

  8. (25%) (50%) (100%) 70 80 90 100 Tm Vs percentage of Complementarity 0 50 100 % Double stranded Temperature (C)

  9. Stringency • Percentage of complementarity required to allow the formation of stable duplexes • The Tm influences the stringency conditions required to allow annealing • A high stringency requires a high level of complementarity • GATCCGGTTATTA vs GATCCGGTTATTA CTAGGCCAATAATCTTGGACGATAAT

  10. Parametersthat Influence Stringency •  [salt] = High stringency •  Temperature = High stringency • [salt] = ? •  Temperature = ?

  11. Method: Transfer and Immobilization onto Solid Support Filter paper - wick 20X SSC Solution– 3M NaCl, 0.3M NaCit. Well Gel Membrane Filter paper Weight Absorbant paper

  12. Wash 4. Hybridization with Free Probe

  13. Detection: Autoradiography

  14. Complete; ideal; 100% complementarity Partial continuous; acceptable 100% complementarity Partial discontinuous; more difficut Partial complementarity Properties of the Probe • Complementarity • Complete or partial?

  15. Hybridization Stringency

  16. The Probe • Labelled DNA or RNA molecule • Single stranded • Strand specific(sensespecific) • Double stranded • Strand non-specific(sensenon specific)

  17. X ray film S S S S ENZ ENZ ENZ ENZ Ab-Dig conjugated Y Y Y Y Probe+ Dig D D D D D D D D Target Membrane Digoxygenin Labelled Probe • Indiret detection Peroxidase

  18. Hybridization Signals • Hybridization • Specific • Non specific • Background • Binding of probe to membrane • Binding of Ab to membrane

  19. Decoding the Genetic Information • Information encoded in nucleotidesequencesiscontained in discreteunits • The genes • The information contained in the genesistranscribed to generate the RNAs and thendecoded (translated) to generate the proteins

  20. Protein Coding Sequences • ProteincontainingsequencescontainORFs • Start – ATG • Stop – TAG, TGA, TAA

  21. Transcription - Translation Transcription: RNA pol Translation: Ribosomes NH3-M-T-R-S-W-G-L-I-S-I-COOH

  22. ORFs • All double strandedsequencesnecessarily have 6 reading frames GCCGATTAGAGA> TGCCGATTAGAG> ATGCCGATTAGA> • 5’-ATGGCGATTAGAGACAGCCATTAA-3’ • 3’-TACTGCTAATCTCTGTCGGTAATT-5’ <CTGTCGGTAATT <TCTGTCGGTAAT <CTCTGTCGGTAA • How many ORFs does this sequence have?

  23. Homologues • Gene sequencesthatpossess a commonancestor • Homologues share a highlevel of identity • Identity • Percentage of bases or aminoacidsthat are the samebetweendifferentsequences

  24. Nucleotide Homologues • DNA sequenceswithgreater 70% identity • Ex. A homologue of the humanhemoglobingeneisfound in soya G.G.T.G.A.G.G.G.T.A.T.C.A.T.C.C.C.A.T.C.T.G G.G.T.C.A.G.G.A.T.A.T.G.A.T.T.C.C.A.T.C.A.C * * * * * * * * * * * * * * * * 77% identity

  25. Protein homologues • Proteinsequenceswithgreaterthan 25% identity • Ex. A protein homologue of the humanhemoglobiisfound in soya G A R G G W L G.G.T.G.A.G.G.G.C.A.T.C.A.T.C.C.C.A.T.C.T G.G.T.C.A.G.G.A.C.A.T.G.A.T.T.C.C.A.T.C.A G T P M I W E Percentageidentity: 28%

  26. Homologues • Orthologues : • Homologues found in differentorganismswhich have a commonancestor • Duplication followed by speciation • Paralogues : • Homologues foundwithin the samespecies • Duplication prior to speciation

  27. Mutations

  28. Types of Missense Point Mutations • Neutral Synonymous/Silent : • Base change that does NOT change the amino acid coded • Ex. AGG → CGG both Arg • Non-Synonymous - Conserved: • Base change results in a different but similar amino acid • Same charge and shape • Ex. AAA → AGA Lys to Arg both basic amino acids

  29. Types of Missense Point Mutations • Non-Synonymous-Semi conserved: • Base change resulting in a different but similar amino acid • Same shape but different charge • Ex. CGC → CUC Arg (Polar) to Leu (Non-polar) • Non-Synonymous - Non conserved • Base change resulting in totally different amino acids • Different shape different charge

More Related