DNA Microarrays for Biomedical Research:
This presentation is the property of its rightful owner.
Sponsored Links
1 / 40

DNA Microarrays for Biomedical Research: Wonders and Cautions PowerPoint PPT Presentation


  • 48 Views
  • Uploaded on
  • Presentation posted in: General

DNA Microarrays for Biomedical Research: Wonders and Cautions. Daniel R. Salomon, M.D. Department of Molecular and Experimental Medicine The Scripps Research Institute. If you don’t understand anything today - it is my fault. This is just technology. 300-500,000 Proteins. What is a gene?.

Download Presentation

DNA Microarrays for Biomedical Research: Wonders and Cautions

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Dna microarrays for biomedical research wonders and cautions

DNA Microarrays for Biomedical Research:

Wonders and Cautions

Daniel R. Salomon, M.D.

Department of Molecular and Experimental Medicine

The Scripps Research Institute


Dna microarrays for biomedical research wonders and cautions

If you don’t understand anything

today - it is my fault.

This is just technology.


Dna microarrays for biomedical research wonders and cautions

300-500,000

Proteins

What is a gene?

30-35,000

Open Reading Frames

(ORFs)

Genome

Transcriptosome

Proteosome


Dna microarrays for biomedical research wonders and cautions

Environment: ECM, Ischemia, Stress

Growth Factors

Cytokines

Development/Differentiation Programs

Baseline/Constitutive

Activated

What happens immediately, what happens next?


Dna microarrays for biomedical research wonders and cautions

Tissues are complex mixtures

of different cell types.

Infiltrating

Inflammatory

Cells

Endothelium

Epithelium

Mesenchymal Elements


Dna microarrays for biomedical research wonders and cautions

How are signal pathways

regulated by transcription?


Gene discovery vs custom arrays

Gene Discovery vs. Custom Arrays

  • “Gene Discovery Arrays” Affymetrix GeneChips Incyte

    Rosetta

    Filter arrays

  • “Custom DNA Microarrays” Low-cost Replicate data points Focused sets of genes


Dna microarrays for biomedical research wonders and cautions

Affymetrix Chip Technology


Dna microarrays for biomedical research wonders and cautions

Affymetrix: Photolithography-based Gene Chip Printing


Dna microarrays for biomedical research wonders and cautions

Affymetrix Chip System

Chip

Hybe/Wash

Station

Array

Scanner

Informatics

Work Station


Dna microarrays for biomedical research wonders and cautions

Processing Microarray Image Data - Step 1

Scanning Image

Red - Cy5

Green - Cy3

Yellow - Both


Dna microarrays for biomedical research wonders and cautions

Processing Microarray Image Data - Step 2

Creating an image mask


Dna microarrays for biomedical research wonders and cautions

Processing Microarray Image Data - Step 3

Analyzing probe intensity at a single spot


Dna microarrays for biomedical research wonders and cautions

Processing Microarray Image Data - Step 4

Comparing multiple time points or conditions


Image analysis

Image Analysis

  • ImaGene (Biodiscovery)

  • QuantArray (GSI Lumonics)

  • Affymetrix GeneChip software


Data analysis

Data Analysis

  • Excel

  • GeneSpring (Silicon Genetics)

  • Affymetrix GeneChip software

  • Cluster/Treeview (Stanford)

  • NFUEGO, Promoter Cruncher, Chip Annotation databases


Dna microarrays for biomedical research wonders and cautions

Image files

(from Affymetrix or

Custom slide arrays)

Microarray specs

Patient/Clinical data

To

Web

Database

Server

Annotation

Database

Promoter

Cruncher

User Workstations

ImaGene, GeneSpring, Cluster/Treeview

GeneChip, NFUEGO


Dna microarrays for biomedical research wonders and cautions

A

C

B


Dna microarrays for biomedical research wonders and cautions

Affymetrix Chip HG U95A


Dna microarrays for biomedical research wonders and cautions

Incyte Genomics: Human UniGene I Array

(8393 unique genes or ESTs)

Clone IDAccession #Gene Name

1362728 AF068236nitric oxide synthase 2A (inducible, hepatocytes)

1363074 BF035921lymphocyte cytosolic protein 1 (L-plastin)

1363684 NM_014823KIAA0344 gene product

1363832 NM_006405transmembrane 9 superfamily member 1

1364004 AA778107Homo sapiens mRNA; cDNA DKFZp586O2124

1364225 AW136140Homo sapiens cDNA: FLJ23053 fis, clone LNG02858

1365434 AI627624zinc finger protein 195

1365507 BE045743LBP protein 32

1365962 U75898heat shock 27kD protein 2

1365975 AA595575Homo sapiens cDNA: FLJ23516 fis, clone LNG04848

1366043 BE043061Homo sapiens cDNA FLJ12366 fis, clone MAMMA1002411

1366085 NM_001129AE-binding protein 1

1366602 AI416967MUM2 protein

1366614 N68666f-box and leucine-rich repeat protein 7

1366817 R58925EST

1366978 AF007170DEME-6 protein

1367201 AI754198KIAA0076 gene product

1367516 AA813998ESTs

1367527 AF072164HsHomo sapiens HSFE-1 mRNA, partial cds

1367862 H39214ESTs

1368173 Y00698phosphofructokinase, muscle

1368319 AA348317ESTs

1368493 AK000005FLJ00005 protein

1368653 X57548cadherin 2, type 1, N-cadherin (neuronal)


Dna microarrays for biomedical research wonders and cautions

http://www.gene.ucl.ac.uk/cgi-bin/nomenclature/

Human Gene Nomenclature Database: Genew3 Search

Search of Approved Symbols AND Literature Aliases from this page [help]

This public copy of the database was last updated on Wed Apr 11, 2001

Now containing 12892 active gene symbols

and 8700 literature aliases

and 2634 withdrawn symbols

Quick search by first letter of symbol [help]

ABCDEFGHIJKLMNOPQRSTUVWXYZ


Dna microarrays for biomedical research wonders and cautions

Page 1 of 4: Cadherins

SymbolFull NameCytogenetic LocationPubMed ID

CDH1cadherin 1, type 1, E-cadherin (epithelial)16q22.19925936

CDH2cadherin 2, type 1, N-cadherin (neuronal)18q12.12384753

CDH3cadherin 3, type 1, P-cadherin (placental) 16q22.11427864

CDH4cadherin 4, type 1, R-cadherin (retinal)20q13.310191097

CDH5cadherin 5, type 2, VE-cadherin reserved2059658

CDH6cadherin 6, type 2, K-cadherin (fetal kidney)5p14-p15.17743525

CDH7cadherin 7, type 218q22-q239615235

CDH8cadherin 8, type 216q22.19615235

CDH9cadherin 9, type 2 (T1-cadherin)reserved2059658

CDH10cadherin 10, type 2 (T2-cadherin)5p13-p142059658

CDH11cadherin 11, type 2, (osteoblast)16q22.19615235

CDH12cadherin 12, type 2 (N-cadherin 2)5p14-p137731968

CDH12Pcadherin 12 (N-cadherin 2) pseudogene5q137731968

CDH13cadherin 13, H-cadherin (heart)16q24.28673923

CDH15cadherin 15, M-cadherin (myotubule)16q24.31427864

CDH16cadherin 16, KSP-cadherin16q21-q229721215

CDH17cadherin 17, LI cadherin (liver-intestine)8q22.2-q22.39615235

CDH18cadherin 18, type 25p15.1-p15.29030594

CDH19cadherin 19, type 218q22-q23

CDH20cadherin 20, type 218q22-q23

CDH21cadherin 21reserved

CDH23cadherin related 2310q21-q2211090341

CDH24cadherin-like 24reserved


Dna microarrays for biomedical research wonders and cautions

PubMed Reference for Cadherin 2

N-cadherin gene maps to human chromosome 18 and is

not linked to the E-cadherin gene.

Walsh FS, Barton CH, Putt W, Moore SE, Kelsell D, Spurr N, Goodfellow PN.

Department of Experimental Pathology, UMDS, Guy's Hospital, London, England.

cDNA clones encoding the human N-cadherin cell adhesion molecule have been isolated from an embryonic muscle library by screening

with an oligonucleotide probe complementary to the chick brain sequence and chick brain cDNA probe lambda N2. Comparison of the

predicted protein sequences revealed greater than 91% homology between chick brain, mouse brain, and human muscle N-cadherin cDNAs

over the 748 amino acids of the mature, processed protein. A single polyadenylation site in the chick clone was also present and duplicated

in the human muscle sequence. Immediately 3' of the recognition site in chick a poly(A) tail ensued; however, in human an additional 800 bp

of 3' untranslated sequence followed. Northern analysis identified a number of major N-cadherin mRNAs. These were of 5.2, 4.3, and 4.0 kb

in C6 glioma, 4.3 and 4.0 kb in human foetal muscle cultures, and 4.3 kb in human embryonic brain and mouse brain with minor bands of

5.2 kb in human muscle and embryonic brain. Southern analysis of a panel of somatic cell hybrids allowed the human N-cadherin gene to be

mapped to chromosome 18. This is distinct from the E-cadherin locus on chromosome 16. Therefore, it is likely that the cadherins have

evolved from a common precursor gene that has undergone duplication and migration to other chromosomal locations.


Dna microarrays for biomedical research wonders and cautions

http://www.gdb.org/

Search bySubmit

Genomic Segments Name/GDB ID

All Biological DataKeyword

People DNA Sequence ID

Citations

Gene List - Accession #, Map Coordinates


Dna microarrays for biomedical research wonders and cautions

Gene Map of Chromosome 8q13.3-8q24.22

Displayed by MapView 2.4


Custom microarray printing

Custom Microarray Printing

  • Glass slide substrate

  • 500-10,000 spots/slide

  • Robotic spotting device

  • cDNA clones

  • PCR products

  • Oligonucleotides

    • (50-70mers)


Dna microarrays for biomedical research wonders and cautions

The Mguide: A complete guide to building your own microarrayer.

http://cmgm.stanford.edu/pbrown/mguide


Oligonucleotides 50 70mers

Oligonucleotides (50-70mers)

  • are sequence verified

  • eliminate clone library banking

  • eliminate PCR and PCR contamination issues

  • are inexpensive (500ng of purified 75mer will print 12,000 arrays each with 3 replicate spots)

  • can be directed at specific exons to detect splice variants

  • can be designed to distinguish closely related genes


Array based genotyping vs gene expression analysis

Genotyping

Gene Expression

  • 1-40 markers/sample

  • multiple samples/chip

  • sample tracking

  • automated sample and reagent handling

  • 2-4 color fluorescence

  • detection

  • 100-10,000 genes / chip

  • 1-2 samples/chip

  • library of array elements

  • high speed/high density printing

  • data interpretation

  • database management

Array-based genotyping vs.gene expression analysis

:::::::::::::::::::::::::

:::::::::::::::::::::::::

:::::::::::::::::::::::::

:::::::::::::::::::::::::

:::::::::::::::::::::::::

:::::::::::::::

:::::::::::::::

:::::::::::::::

:::::::::::::::


Solid phase primer extension assay mini sequencing genetic bit analysis gba

Solid-phase primer extension assay:“Mini-sequencing”, “Genetic Bit Analysis (GBA)”

1. Hybridization of template DNA to solid-phase primer

5’

X=C/T polymorphism

3’

Hybridized

template

TACGTGACTGATGCTTAGCTTCAATGAGXTGATGTAG

|||||||||||||||||||||

GACTACGAATCGAAGTTACTC

Solid-phase oligonucleotide

Glass slide


Dna microarrays for biomedical research wonders and cautions

3mm


A microarray strategy

A Microarray Strategy

Gene Discovery

(large arrays, limited

numbers of samples)

Custom DNA microarrays

(small arrays, large

numbers of samples)

Genotyping (SNPs)


Dna microarrays for biomedical research wonders and cautions

The challenges for chip technology I.

  • Incredible amounts of “data”

  • An incomplete database

  • Technical issues involving multiple technologies

  • Relatively primitive tools for handling data

  • Major issues for statistical methodologies

    • Normalization

    • Replicates

    • Significant changes


Dna microarrays for biomedical research wonders and cautions

The challenges for chip technology II.

  • Major challenge to scientific thought and method

  • Big science or “organismal” biology

  • Hypothesis-driven vs. “Fishing Expedition”

  • How is the transcriptosome regulating the proteome?


Rna signal amplification

Clinical Specimens

Laser Capture Microscopy

RNA/Signal Amplification


  • Login