The human genome project at uc santa cruz
This presentation is the property of its rightful owner.
Sponsored Links
1 / 32

The Human Genome Project at UC Santa Cruz PowerPoint PPT Presentation


  • 87 Views
  • Uploaded on
  • Presentation posted in: General

The Human Genome Project at UC Santa Cruz. Phoenix Eagleshadow November 9, 2004. The Human Genome Project Began in 1990. The Mission of the HGP: The quest to understand the human genome and the role it plays in both health and disease.

Download Presentation

The Human Genome Project at UC Santa Cruz

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


The human genome project at uc santa cruz

The Human Genome Project at UC Santa Cruz

Phoenix Eagleshadow

November 9, 2004


The human genome project began in 1990

The Human Genome Project Began in 1990

  • The Mission of the HGP: The quest to understand the human genome and the role it plays in both health and disease.

“The true payoff from the HGP will be the ability to better diagnose, treat, and prevent disease.”

--- Francis Collins, Director of the HGP and the National Human Genome Research Institute (NHGRI)


The genome is our genetic blueprint

The genome is our Genetic Blueprint

  • Nearly every human cell contains 23 pairs of chromosomes

    • 1 - 22 and XY or XX

      • XY = Male

      • XX = Female

  • Length of chr 1-22, X, Y together is ~3.2 billion bases (about 2 meters diploid)


The genome is who we are on the inside

The Genome is Who We Are on the inside!

Information coded in DNA

  • Chromosomes consist of DNA

    • molecular strings of A, C, G, & T

    • base pairs, A-T, C-G

  • Genes

    • DNA sequences that encode proteins

    • less than 3% of human genome


The human genome project at uc santa cruz

5000 bases per page

CACACTTGCATGTGAGAGCTTCTAATATCTAAATTAATGTTGAATCATTATTCAGAAACAGAGAGCTAACTGTTATCCCATCCTGACTTTATTCTTTATG AGAAAAATACAGTGATTCC

AAGTTACCAAGTTAGTGCTGCTTGCTTTATAAATGAAGTAATATTTTAAAAGTTGTGCATAAGTTAAAATTCAGAAATAAAACTTCATCCTAAAACTCTGTGTGTTGCTTTAAATAATC

AGAGCATCTGC TACTTAATTTTTTGTGTGTGGGTGCACAATAGATGTTTAATGAGATCCTGTCATCTGTCTGCTTTTTTATTGTAAAACAGGAGGGGTTTTAATACTGGAGGAACAA

CTGATGTACCTCTGAAAAGAGA AGAGATTAGTTATTAATTGAATTGAGGGTTGTCTTGTCTTAGTAGCTTTTATTCTCTAGGTACTATTTGATTATGATTGTGAAAATAGAATTTATCC

CTCATTAAATGTAAAATCAACAGGAGAATAGCAAAAACTTATGAGATAGATGAACGTTGTGTGAGTGGCATGGTTTAATTTGTTTGGAAGAAGCACTTGCCCCAGAAGATACACAAT

GAAATTCATGTTATTGAGTAGAGTAGTAATACAGTGTGTTCCCTTGTGAAGTTCATAACCAAGAATTTTAGTAGTGGATAGGTAGGCTGAATAACTGACTTCCTATC ATTTTCAGGTT

CTGCGTTTGATTTTTTTTACATATTAATTTCTTTGATCCACATTAAGCTCAGTTATGTATTTCCATTTTATAAATGAAAAAAAATAGGCACTTGCAAATGTCAGATCACTTGCCTGTGGT

CATTCGGGTAGAGATTTGTGGAGCTAAGTTGGTCTTAATCAAATGTCAAGCTTTTTTTTTTCTTATAAAATATAGGTTTTAATATGAGTTTTAAAATAAAATTAATTAGAAAAAGGCAA

ATTACTCAATATATATAAGGTATTGCATTTGTAATAGGTAGGTATTTCATTTTCTAGTTATGGTGGGATATTATTCAGACTATAATTCCCAATGAAAAAACTTTAAAAAATGCTAGTGA

TTGCACACTTAAAACACCTTTTAAAAAGCATTGAGAGCTTATAAAATTTTAATGAGTGATAAAACCAAATTTGAAGAGAAAAGAAGAACCCAGAGAGGTAAGGATATAACCTTACC

AGTTGCAATTTGCCGATCTCTACAAATATTAATATTTATTTTGACAGTTTCAGGGTGAATGAGAAAGAAACCAAAACCCAAGACTAGCATATGTTGTCTTCTTAAGGAGCCCTCCCCT

AAAAGATTGAGATGACCAAATCTTATACTCTCAGCATAAGGTGAACCAGACAGACCTAAAGCAGTGGTAGCTTGGATCCACTACTTGGGTTTGTGTGTGGCGTGACTCAGGTAATCT

CAAGAATTGAACATTTTTTTAAGGTGGTCCTACTCATACACTGCCCAGGTATTAGGGAGAAGCAAATCTGAATGCTTTATAAAAATACCCTAAAGCTAAATCTTACAATATTCTCAAG

AACACAGTGAA ACAAGGCAAAATAAGTTAAAATCAACAAAAACAACATGAAACATAATTAGACACACAAAGACTTCAAACATTGGAAAATACCAGAGAAAGATAATAAATAT

TTTACTCTTTAAAAATTTAGTTAAAAGCTTAAACTAATTGTAGAGAAAA AACTATGTTAGTATTATATTGTAGATGAAATAAGCAAAACATTTAAAATACAAATGTGATTACTTAAAT

TAAATATAATAGATAATTTACCACCAGATTAGATACCATTGAAGGAATAATTAATATACTGAAATACAGGTCAGTAGAATTTTTTTCAATTCAGCATGGAGATGTAAAAAATGAAAA

TTAATGCAAAAAATAAGGGCACAAAAAGAAATGAGTAATTTTGATCAGAAATGTATTAAAATTAATAAACTGGAAATTTGACATTTAAAAAAAGCATTGTCATCCAAGTAGATGTG

TCTATTAAATAGTTGTTCTCATATCCAGTAATGTAATTATTATTCCCTCTCATGCAGTTCAGATTCTGGGGTAATCTTTAGACATCAGTTTTGTCTTTTATATTATTTATTCTGTTTACTAC

ATTTTATTTTGCTAATGATATTTTTAATTTCTGACATTCTGGAGTATTGCTTGTAAAAGGTATTTTTAAAAATACTTTATGGTTATTTTTGTGATTCCTATTCCTCTATGGACACCAAGGCT

ATTGACATTTTCTTTGGTTTCTTCTGTTACTTCTATTTTCTTAGTGTTTATATCATTTCATAGATAGGATATTCTTTATTTTTTATTTTTATTTAAATATTTGGTGATTCTTGGTTTTCTCAGCC

ATCTATTGTCAAGTGTTCTTATTAAGCATTATTATTAAATAAAGATTATTTCCTCTAATCACATGAGAATCTTTATTTCCCCCAAGTAATTGAAAATTGCAATGCCATGCTGCCATGTGG

TACAGCATGGGTTTGGGCTTGCTTTCTTCTTTTTTTTTTAACTTTTATTTTAGGTTTGGGAGTACCTGTGAAAGTTTGTTATATAGGTAAACTCGTGTCACCAGGGTTTGTTGTACAGATCA

TTTTGTCACCTAGGTACCAAGTACTCAACAATTATTTTTCCTGCTCCTCTGTCTCCTGTCACCCTCCACTCTCAAGTAGACTCCGGTGTCTGCTGTTCCATTCTTTGTGTCCATGTGTTCTC

ATAATTTAGTTCCCCACTTGTAAGTGAGAACATGCAGTATTTTCTAGTATTTGGTTTTTTGTTCCTGTGTTAATTTGCCCAGTATAATAGCCTCCAGCTCCATCCATGTTACTGCAAAGAA

CATGATCTCATTCTTTTTTATAGCTCCATGGTGTCTATATACCACATTTTCTTTATCTAAACTCTTATTGATGAGCATTGAGGTGGATTCTATGTCTTTGCTATTGTGCATATTGCTGCAAG

AACATTTGTGTGCATGTGTCTTTATGGTAGAATGATATATTTTCTTCTGGGTATATATGCAGTAATGCGATTGCTGGTTGGAATGGTAGTTCTGCTTTTATCTCTTTGAGGAATTGCCATG

CTGCTTTCCACAATAGTTGAACTAACTTACACTCCCACTAACAGTGTGTAAGTGTTTCCTTTTCTCCACAACCTGCCAGCATCTGTTATTTTTTGACATTTTAATAGTAGCCATTTTAACT

GGTATGAAATTATATTTCATTGTGGTTTTAATTTGCATTTCTCTAATGATCAGTGATATTGAGTTTGTTTTTTTTCACATGCTTGTTGGCTGCATGTATGTCTTCTTTTAAAAAGTGTCTGTT

CATGTACTTTGCCCACATTTTAATGGGGTTGTTTTTCTCTTGTAAATTTGTTTAAATTCCTTATAGGTGCTGGATTTTAGACATTTGTCAGACGCATAGTTTGCAAATAGTTTCTCCCATTC

TGTAGGTTGTCTGTTTATTTTGTTAATAGTTTCTTTTGCTATGCAGAAGCTCTTAATAAGTTTAATGAGATCCTGATATGTTAGGCTTTGTGTCCCCACCCAAATCTCATCTTGAATTATA

TCTCCATAATCACCACATGGAGAGACCAGGTGGAGGTAATTGAATCTGGGGGTGGTTTCACCCATGCTGTTCTTGTGATAGTGAATGAGTTCTCACGAGATCTAATGGTTTTATGAGG

GGCTCTTCCCAGCTTTGCCTGGTACTTCTCCTTCCTGCCGCTTTGTGAAAAAGGTGCATTGCGTCCCTTTCACCTTCTTCTATAATTGTAAGTTTCCTGAGGCCTTCCCAGCCATGCTGAA

CTTCAAGTCAATTAAACCTTTTTCTTTATAAATTACTCAGTCTCTGGTGGTTCTTTATAGCAGTGTGAAAATGGACTAATGAAGTTCCCATTTATGAATTTTTGCTTTTGTTGCAATTGCTT

TTGACATCTTAGTCATGAAATCCTTGCCTGTTCTAAGTACAGGACGGTATTGCCTAGGTTGTCTTCCAGGGTTTTTCTAATTTTGTGTTTTGCATTTAAGTGTTTAATCCATCTTGAGTTGA

TTTTTGTATATTGTGTAAGGAAGGGGTCCAGTTTCAATCTTTTGCATATGGCTAGTTAGTTATCCCAGTACCATTTATTGAAAAGACAGTCTTTTCCCCATCGCTCGTTTTTGTCAGTTTT

ATTGATGATCAGATAATCATAGCTGTGTGGCTTTATTTCTGGGTTCTTTATTCTGTTCTATTGGTTTATGTCCCTGTTTTTGTGCCAGTACCATGCTGTTTTGGTTAACATAGCCCTGTAGT

ATAGTTTGAGGTCAGATAGCCTGATGCTTCCAGCTTTGTTCTTTTTCTTAAGATTGCCTTGGCTATTTGGCCTCTTTTTTGGTTCCACATGAATTTTAAAACAGTTGTTTCTAGTTTTTGAA

GAATGTCATTGGTAGTTTGATAGAAATAGCATTTAATCTGTAAATTGATTTGTGCAGTATGGCCTTTTAATGATATTGATTCTTCCTATCCATGAGCATGATATGTTTTCCATTTTGTTTG

TATCCTCTCTGATTTCTTTGTGCAGTGTTTTGTAATTCTCAT TGTAGAGATTTTTCACCTCCCTGGTTAGTTGTATTTTACCCTAGATATTT TATTCTTTTTGTGAAAATTGTGAATGGGAT

TGCCTTCCTGATTTGACTGC CAGCTTGGTTACTGTTGGTTTATAGAAATGCTAGTGATTTTTGTACATTG ATTTTCTTTCTAAAACTTTGCTGAAGTTTTTTTTATTAGCAGAAGGAGCT

TTGGGGCTGAGACTATGGGGTTTTCTAGATATAGAATCATGTCAGCTTCAAATAGGGATAATTTTACTTCCTCTCTTCCTATTTGGATGCCCTTTATTTCTTTCTCTTGCCTGATTACTCTG

GCTGGGATTTCCTATGTTGAATAGGAGT CATGAGAGAGGGCATCAAATCTACACATATCAAATACTAACCTTGAATGTCTAGATATTT TATTCTTTTTGTGAAAATTGTGAATGGGAT


How much data make up the human genome

How much data make up the human genome?

  • 3 pallets with 40 boxes per pallet x 5000 pages per box x 5000 bases per page = 3,000,000,000 bases!

  • To get accurate

    sequence requires

    6-fold coverage.

  • Now: Shred 18 pallets

    and reassemble.


The beginning of the project

The Beginning of the Project

  • Most the first 10 years of the project were spent improving the technology to sequence and analyze DNA.

  • Scientists all around the world worked to make detailed maps of our chromosomes and sequence model organisms, like worm, fruit fly, and mouse.


Uc santa cruz gets involved

UC Santa Cruz gets Involved

Because of the work Professor David Haussler was doing in the field of computational biology, UC Santa Cruz was invited to participate in the HGP in late of 1999.

Computational biology (or Bioinformatics) is a research field that uses computers to help solve biological problems


The human genome project at uc santa cruz

The Tech Awards honors the UCSC Genome Bioinformatics Group in 2003!


The challenges were overwhelming

The Challenges were Overwhelming

  • First there was the Assembly

    The DNA sequence is so long that no technology can read it all at once, so it was broken into pieces.

    There were millions of clones (small sequence fragments).

    The assembly process included finding where the pieces overlapped in order to put the draft together.

3,200,000 piece puzzle anyone?


The human genome project at uc santa cruz

The “Working Draft” of the human genome

ACCTTGG

CCTGAAT

CTAGGCT

TTGCATC

CCTAGTC

CTGATCG

Freeze of sequence data

generated by NCBI

Clone layouts generated

By Washington University

sequence

Clone

maps

Assembly generated by

UCSC

Working draft assembly


Ucsc put the human genome sequence on the web july 7 2000

UCSC put the human genome sequence on the web July 7, 2000

Cyber geeks

Searched for hidden

Messages, and

“GATTACA”

UCSC put the human genome sequence on CD in October 2000, with varying results


The completion of the human genome sequence

The Completion of the Human Genome Sequence

  • June 2000 White House announcement that the majority of the human genome (80%) had been sequenced (working draft).

  • Working draft made available on the web July 2000 at genome.ucsc.edu.

  • Publication of 90 percent of the sequence in the February 2001 issue of the journal Nature.

  • Completion of 99.99% of the genome as finished sequence on July 2003.


The project is not done

The Project is not Done…

  • Next there is the Annotation:

    The sequence is like a topographical map, the annotation would include cities, towns, schools, libraries and coffee shops!

    So, where are the genes?

How do genes work?

And, how do scientists use this information for scientific understanding and to benefit us?


What do genes do anyway

What do genes do anyway?

  • We only have ~27,000 genes, so that means that each gene has to do a lot.

  • Genes make proteins that make up nearly all we are (muscles, hair, eyes).

  • Almost everything that happens in our bodies happens because of proteins (walking, digestion, fighting disease).

OR

OR

Eye Color and Hair Color

are determined by genes


Of mice and men it s all in the genes

Of Mice and Men:It’s all in the genes

Humans and Mice have about the same number of genes. But we are so different from each other, how is this possible?

One human gene can make many different proteins while a mouse gene can only make a few!

Did you say cheese?

Mmm, Cheese!


Genes are important

Genes are important

  • By selecting different pieces of a gene, your body can make many kinds of proteins. (This process is called alternative splicing.)

  • If a gene is “expressed” that means it is turned on and it will make proteins.


What we ve learned from our genome so far

What we’ve learned from our genome so far…

  • There are a relatively small number of human genes, less than 30,000, but they have a complex architecture that we are only beginning to understand and appreciate.

    -We know where 85% of genes are in the sequence.

    -We don’t know where the other 15% are because we haven’t seen them “on” (they may only be expressed during fetal development).

    -We only know what about 20% of our genes do so far.

  • So it is relatively easy to locate genes in the genome, but it is hard to figure out what they do.


How do scientists find genes

How do scientists find genes?

  • The genome is so large that useful information is hard to find.

  • Researchers at UCSC decided to make a computational microscope to help scientists search the genome.

  • Just as you would use “google” to find something on the internet, researchers can use the “UCSC Genome Browser” to find information in the human genome.

Explore it at http://genome.ucsc.edu


The ucsc genome browser

The UCSC Genome Browser


The browser takes you from early maps of the genome

The browser takes you from early maps of the genome . . .


To a multi resolution view

. . . to a multi-resolution view . . .


At the gene cluster level

. . . at the gene cluster level . . .


The single gene level

. . . the single gene level . . .


The single exon level

. . . the single exon level . . .


And at the single base level

. . . and at the single base level

caggcggactcagtggatctggccagctgtgacttgacaag

caggcggactcagtggatctagccagctgtgacttgacaag


The continuing project

The Continuing Project

  • Finding the complete set of genes and annotating the entire sequence. Annotation is like detailing; scientists annotate sequence by listing what has been learn experimentally and computationally about its function.

  • Proteomics is studying the structure and function of groups of proteins. Proteins are really important, but we don’t really understand how they work.

  • Comparative Genomics is the process of comparing different genomes in order to better understand what they do and how they work. Like comparing humans, chimpanzees, and mice that are all mammals but all very different.


Who works on this stuff anyway

Who works on this stuff anyway?

  • Biologists and Chemists understand the physical sciences-they take biology and chemistry classes.

  • Computer Scientists program the computers (the same people who make video games!)-they take math and computer classes.

  • Computer Engineers try to build better, faster, smarter computers-they take math, physics and computer classes.

  • Social Scientists try to understand how this new information and technology will impact our lives-they take sociology and philosophy classes.


Ucsc summer workshop on human genome research

UCSC Summer Workshop on Human Genome Research

  • Held annually in July

  • It’s a free event for students and teachers

  • Workshops by faculty and researchers on a wide array of topics

  • Tours of our laboratories and kilocluster

  • Free breakfast and lunch

  • Travel funds are available

  • RSVP: 831-459-1702 or [email protected]


How can i work on this project or something like it

How can I work on this project, or something like it?

  • Read about it, online at www.genome.gov, or in Nature, Science, or other scientific magazines.

  • Take classes in biology, chemistry, math, physics and English classes at high school.

  • OR take classes at your local community college or University-Extension in biology, bioinformatics, or genetics.

  • Go to college and get a degree in science, engineering, math, or social sciences.


Bioinformatics opportunities

Bioinformatics Opportunities

Director/Professor -

University

Company

National Laboratory

Research Foundation

Bioinformatics

Biochemistry

Biology

Computer Science

Computer Engineering

Mathematics

Ocean Sciences

Physics

(Education, Sociology, Philosophy, Psychology, Community Studies)

A research degree in any of these majors will take you far!

PhD

Research Staff -

Company/University

National Laboratory

Research Foundation

Teaching -

Community College

Public Schools

MS (MA)

BS (BA)

Entry-Level -

Company

National Laboratory

Teaching –

Private Schools


Thank you for letting us come talk to you today and share what we do

Thank you for letting us come talk to you today and share what we do!

Come to UCSC, Slugs are cool!

Bye!


  • Login