Transcription
This presentation is the property of its rightful owner.
Sponsored Links
1 / 18

Transcription PowerPoint PPT Presentation


  • 73 Views
  • Uploaded on
  • Presentation posted in: General

Transcription. Chapter 7-2. Review Standard 1d. 1d: Students know the central dogma of molecular biology outlines the flow of information from transcription of ribonucleic acid (RNA) in the nucleus to translation of proteins on ribosomes in the cytoplasm. Today, we will discuss transcription.

Download Presentation

Transcription

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Transcription

Transcription

Chapter 7-2


Review standard 1d

Review Standard 1d

  • 1d: Students know the central dogma of molecular biology outlines the flow of information from transcription of ribonucleic acid (RNA) in the nucleus to translation of proteins on ribosomes in the cytoplasm.

  • Today, we will discuss transcription


Presentation outline

Presentation outline

  • RNA and Transcription

    A.Central Dogma of Molecular Biology

    B.The Structure of RNA

    • Transcription

    • Types of RNA

    • Role of DNA and RNA

Go to Section:


Purpose of dna

Purpose of DNA

  • DNA holds the genetic information.

    • A blueprint for the cell

    • It tells the cell what to build

  • The purpose of DNA

    • DNA codes for the proteins that make up an organism

  • The other day we talked about replicating (copying) DNA

  • Today, we talk about the steps to make proteins (building materials) from DNA


Central dogma of molecular biology

Central Dogma of Molecular Biology

  • DNA

  • RNA

  • Protein


But how does dna store the info

But how does DNA store the info?

  • DNA is made up of nucleotides

  • Nucleotides consist of:

    • A phosphate

    • A sugar (deoxyribose)

    • A base (A,T,C,G)

  • How could DNA code for a protein?

  • Let’s look at the structure of DNA again!


Structure of dna

Structure of DNA

Nucleotide

Hydrogen bonds

Sugar-phosphate backbone

Key

Adenine (A)

Thymine (T)

Cytosine (C)

Guanine (G)

Go to Section:


The sequence of bases

The sequence of bases

  • The varying sequence of bases is like a code

  • You can compare it to the alphabet and words

  • For example, we have 26 letters in the alphabet. If you combine the letters into certain sequences you can get a word with a meaning

    • Uoy rea unfny

    • You are funny


The sequence of bases1

The sequence of bases

  • The same thing can be said about DNA

  • The sequence (order) of bases determine the type of protein produced

    • ACTTCGATCGGTCAGTCAGTCAGTTACGAT

    • Black colored hair


Interest grabber

Interest Grabber

  • Information, Please

  • DNA contains the information that a cell needs to carry out all of its functions. In a way, DNA is like the cell’s encyclopedia. Suppose that you go to the library to do research for a science project. You find the information in an encyclopedia. You go to the desk to sign out the book, but the librarian informs you that this book is for reference only and may not be taken out.

1. Why do you think the library holds some books for reference only?

2. If you can’t borrow a book, how can you take home the information in it?

3. All of the parts of a cell are controlled by the information in DNA, yet DNA does not leave the nucleus. How do you think the information in DNA might get from the nucleus to the rest of the cell?

Go to Section:


Transcription1

Transcription

Adenine (DNA and RNA)

Cystosine (DNA and RNA)

Guanine(DNA and RNA)

Thymine (DNA only)

Uracil (RNA only)

RNApolymerase

DNA

RNA

Go to Section:


Transcription2

Transcription

  • DNA cannot exit outside of the nucleus

  • Instead a copy (message) must be made so it can be sent out

  • RNA polymerase copies the DNA into RNA (message)

  • NOTICE: NO “T” in RNA sequence


Structural differences between dna and rna

DNA

Double stranded

Sugar

deoxyribose

Consists of bases

A,T,C,G

Located in the nucleus

RNA

Single stranded

Sugar

ribose

Consists of bases

A,U,C,G

Can exit the nucleus into the cytoplasm of the cell

Structural differences between DNA and RNA


Different types of rna

Messenger RNA

Ribosomal RNA

Transfer RNA

Bringamino acids toribosome

Combine

with proteins

tRNA

mRNA

Carry instructions

rRNA

DNA

Ribosome

Ribosomes

Different types of RNA

RNA

can be

also called

which functions to

also called

which functions to

also called

which functions to

from

to

to make up

Go to Section:


The genetic code

The Genetic Code

Go to Section:


Review

Review

  • DNA to DNA - Purpose of DNA replication

    • To make copies of the DNA for cell division

  • DNA to RNA – Purpose of transcription

    • To make a copy of the blueprint that codes for the amino acids (proteins)

  • RNA to protein – Purpose of translation???


  • Login