Introduction the central dogma of molecular biology
Sponsored Links
This presentation is the property of its rightful owner.
1 / 38

Introduction The Central Dogma of Molecular Biology PowerPoint PPT Presentation

  • Uploaded on
  • Presentation posted in: General

DNA. Transcription. Ribosome. mRNA. Translation. Polypeptide (protein). Introduction The Central Dogma of Molecular Biology. Cell. Protein Synthesis. Flow of Information: DNA RNA Protein Transcription Translation Transcription: DNA is copied into

Download Presentation

Introduction The Central Dogma of Molecular Biology

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript








IntroductionThe Central Dogma of Molecular Biology


Protein Synthesis

Flow of Information:

DNA RNA Protein

Transcription Translation

Transcription: DNA is copied into

messenger RNA (mRNA).

This messenger brings code from nucleus to ribosome where translation occurs.

Protein Synthesis

Transcription process:

DNA unzips and one strandserves as a template.

The RNA bases attach to the DNA template, thus assembling mRNA.

mRNA leaves the nucleus and travels to the ribosome in the cytoplasm.
















Eukaryotic Transcription

RNA Transcription

Step 1: Hydrogen bonds

between complimentary

bases break

DNA “unzips”

RNA Transcription

Step 2: DNA strands

pull apart from each other

RNA Transcription

Step 3:

RNA nucleotides in the nucleus match up with only one side of the

“unzipped” DNA, the sense strand

-each “unzipped’ strands forms a template for a mRNA strand

RNA nucleotide

RNA Transcription

Step 4:

RNA nucleotides continue to match up with “unzipped” DNA

until the message

is completely


mRNA strand

One side of DNA strand

RNA Transcription

mRNA strand

Step 4:

mRNA strand breaks off from the DNA strand

One side of DNA strand

RNA Transcription

Step 5:

mRNA strand leaves the nucleus for the ribosome

RNA Transcription

Step 6: Once the mRNA

leaves, the DNA “zips”

back together

Protein Synthesis: Transcription



Translation: at ribosomes

  • mRNA dictates the amino acid sequence of a protein.

  • 1 Strand RNA  Amino Acid Chain  Protein

Translation process:

Protein Synthesis:

Translation:mRNA codes for a polypeptide chain orprotein.

Each combination of 3 nucleotides on mRNA is called a codon:

Each codon specifies a particular amino acid.

Translation continued:

Transfer RNA (tRNA): carries amino acids to mRNA in ribosome to assemble an amino acid chain – protein.

tRNA molecules have 2 important sites of attachment.

  • One site, called the anticodon, binds to the codon on the mRNA molecule.

  • The other site attaches to a particular aminoacid.


























































































What is the codon that this tRNA will bind to?

Protein Synthesis: Translation

What are the anti-codons that will bind to these codons?

Protein Synthesis: Translation

During protein synthesis, the anticodon of a tRNA molecule base pairs with the appropriate mRNA codon.

Protein Synthesis: Translation


Protein synthesis starts when the two rRNA subunitsbind to mRNA.

The initiator codon AUG binds to the first anticodon of tRNA, signaling the start of aprotein.

Protein Synthesis: Translation


The anticodon of another tRNA binds to the next mRNA codon, bringing the 2nd aminoacid of the protein.

As each anticodon & codon bind together a peptide bond forms between the two aminoacids.

Protein Synthesis: Translation

The protein chain continues to grow until a stop codon reaches the ribosome, which results in the release of the new protein and mRNA, completing the process of translation.









1 amino acid

Protein Synthesis: Translation

Protein Synthesis: Translation

20 different amino acids are used to make proteins.

4 bases in RNA and 3 bases make up one codon: thus 43 (4x4x4)=64 total codons possible.

DNA sense template = CGATGCCTCGAAGCCTCGATC mRNA = GCUACGGAGCUUCGGAGCUAG7 Anticodons of tRNA = CGAUGCCUCGAAGCCUCGAUCAmino Acid =Alanine+Threonine+Glutamine+Leucine+Argnine+Serine+STOP




Large subunit







Small subunit

Translation - Initiation







Aminoacyl tRNA












Translation - Elongation


















Translation - Elongation

Aminoacyl tRNA































Amino Acid
































Protein Synthesis


















Translation - Elongation








Aminoacyl tRNA













Translation - Elongation




















Translation - Elongation


  • A change in the nitrogenous base sequence of DNA; that change can cause a change in the product coded for by the mutated gene.

  • Neutral

  • Hazardous

  • Beneficial


What happens when you get insertions or deletions of bases in the DNA sequence?

Usually you end up with a mess.


Deletion of one base


And its all pops and buzzes!!

  • Base Substitution

    - One base pair in DNA is replaced with a different base pair (point mutation)

  • Deletion

    - A piece of DNA breaks off and is lost

  • Duplication and Translocation

    - A piece of DNA breaks off and is incorporated into another strand of DNA

  • Frameshift

    - Deletion or Addition results in a shift in the DNA frame

  • Silent mutation

    - codon is changed, but still codes for the same amino acid: serine codons – TCT, TCG, TCA, and TCC




  • Login