Introduction the central dogma of molecular biology
This presentation is the property of its rightful owner.
Sponsored Links
1 / 38

Introduction The Central Dogma of Molecular Biology PowerPoint PPT Presentation


  • 62 Views
  • Uploaded on
  • Presentation posted in: General

DNA. Transcription. Ribosome. mRNA. Translation. Polypeptide (protein). Introduction The Central Dogma of Molecular Biology. Cell. Protein Synthesis. Flow of Information: DNA RNA Protein Transcription Translation Transcription: DNA is copied into

Download Presentation

Introduction The Central Dogma of Molecular Biology

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Introduction the central dogma of molecular biology

DNA

Transcription

Ribosome

mRNA

Translation

Polypeptide

(protein)

IntroductionThe Central Dogma of Molecular Biology

Cell


Protein synthesis

Protein Synthesis

Flow of Information:

DNA RNA Protein

Transcription Translation

Transcription: DNA is copied into

messenger RNA (mRNA).

This messenger brings code from nucleus to ribosome where translation occurs.


Protein synthesis1

Protein Synthesis

Transcription process:

DNA unzips and one strandserves as a template.

The RNA bases attach to the DNA template, thus assembling mRNA.

mRNA leaves the nucleus and travels to the ribosome in the cytoplasm.


Eukaryotic transcription

Cytoplasm

Nuclear

pores

AAAAAA

AAAAAA

DNA

Transcription

RNA

RNA

Processing

G

G

mRNA

Export

Nucleus

Eukaryotic Transcription


Introduction the central dogma of molecular biology

RNA Transcription

Step 1: Hydrogen bonds

between complimentary

bases break

DNA “unzips”


Introduction the central dogma of molecular biology

RNA Transcription

Step 2: DNA strands

pull apart from each other


Introduction the central dogma of molecular biology

RNA Transcription

Step 3:

RNA nucleotides in the nucleus match up with only one side of the

“unzipped” DNA, the sense strand

-each “unzipped’ strands forms a template for a mRNA strand

RNA nucleotide


Introduction the central dogma of molecular biology

RNA Transcription

Step 4:

RNA nucleotides continue to match up with “unzipped” DNA

until the message

is completely

transcribed

mRNA strand

One side of DNA strand


Introduction the central dogma of molecular biology

RNA Transcription

mRNA strand

Step 4:

mRNA strand breaks off from the DNA strand

One side of DNA strand


Introduction the central dogma of molecular biology

RNA Transcription

Step 5:

mRNA strand leaves the nucleus for the ribosome


Introduction the central dogma of molecular biology

RNA Transcription

Step 6: Once the mRNA

leaves, the DNA “zips”

back together


Protein synthesis transcription

Protein Synthesis: Transcription

Transcription

transcription2


Translation at ribosomes

Translation: at ribosomes

  • mRNA dictates the amino acid sequence of a protein.

  • 1 Strand RNA  Amino Acid Chain  Protein


Protein synthesis2

Translation process:

Protein Synthesis:

Translation:mRNA codes for a polypeptide chain orprotein.

Each combination of 3 nucleotides on mRNA is called a codon:

Each codon specifies a particular amino acid.


Translation continued

Translation continued:

Transfer RNA (tRNA): carries amino acids to mRNA in ribosome to assemble an amino acid chain – protein.


Introduction the central dogma of molecular biology

tRNA molecules have 2 important sites of attachment.

  • One site, called the anticodon, binds to the codon on the mRNA molecule.

  • The other site attaches to a particular aminoacid.


Met trna

Methionine

A

C

C

73

1

72

2

71

3

70

4

69

5

68

6

67

59

7

66

Py

A*

U*

65

64

63

62

C

16

Pu

17

9

A

Pu

17:1

13

12

Py

10

49

50

51

52

G

C

T

y

G*

Py

22

23

Pu

25

47:16

G

A

26

47:15

20

20:2

20:1

27

1

43

44

28

42

45

46

29

41

47

30

40

47:1

31

39

Py*

38

U

Pu*

U

34

36

C

35

A

Anticodon

Met-tRNA

What is the codon that this tRNA will bind to?


Protein synthesis translation

Protein Synthesis: Translation

What are the anti-codons that will bind to these codons?


Protein synthesis translation1

Protein Synthesis: Translation

During protein synthesis, the anticodon of a tRNA molecule base pairs with the appropriate mRNA codon.


Protein synthesis translation2

Protein Synthesis: Translation

Ribosome:

Protein synthesis starts when the two rRNA subunitsbind to mRNA.

The initiator codon AUG binds to the first anticodon of tRNA, signaling the start of aprotein.


Protein synthesis translation3

Protein Synthesis: Translation

Ribosome:

The anticodon of another tRNA binds to the next mRNA codon, bringing the 2nd aminoacid of the protein.

As each anticodon & codon bind together a peptide bond forms between the two aminoacids.


Protein synthesis translation4

Protein Synthesis: Translation

The protein chain continues to grow until a stop codon reaches the ribosome, which results in the release of the new protein and mRNA, completing the process of translation.


Introduction the central dogma of molecular biology

DNA

Transcribed

Onto

mRNA

1 CODON

(mRNA)

1 ANTICODON

(tRNA)

1 amino acid


Protein synthesis translation5

Protein Synthesis: Translation

http://www.youtube.com/watch?v=1NkLqjQkGHU&feature=related

http://www.hhmi.org/biointeractive/dna/DNAi_translation_vo2.html


Protein synthesis translation6

Protein Synthesis: Translation

20 different amino acids are used to make proteins.

4 bases in RNA and 3 bases make up one codon: thus 43 (4x4x4)=64 total codons possible.


Introduction the central dogma of molecular biology

DNA sense template = CGATGCCTCGAAGCCTCGATC mRNA = GCUACGGAGCUUCGGAGCUAG7 Anticodons of tRNA = CGAUGCCUCGAAGCCUCGAUCAmino Acid =Alanine+Threonine+Glutamine+Leucine+Argnine+Serine+STOP


Translation initiation

fMet

P

A

Large subunit

E

UAC

5’

GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA

3’

mRNA

Small subunit

Translation - Initiation


Translation elongation

Polypeptide

Arg

Met

Phe

Leu

Ser

Aminoacyl tRNA

Gly

P

A

UCU

Ribosome

E

CCA

5’

GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA

3’

mRNA

Translation - Elongation


Translation elongation1

Polypeptide

Met

Phe

Leu

Ser

Arg

Gly

P

A

Ribosome

E

CCA

UCU

5’

GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA

3’

mRNA

Translation - Elongation

Aminoacyl tRNA


Protein synthesis3

H

O

AMINE

ACID

Alanine

Serine

H

N

C

OH

H

H

O

O

C

H

N

C

OH

H

N

C

OH

R

H

ANYTHING

C

C

H

H

Amino Acid

H

H

C

C

H

H

HO

H

H2O

H

H

O

O

H

N

C

N

C

OH

C

C

H

H

H

H

C

C

H

H

HO

H

Protein Synthesis


Translation elongation2

Polypeptide

Met

Phe

Leu

Ser

Arg

Gly

P

A

Ribosome

E

CCA

UCU

5’

GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA

3’

mRNA

Translation - Elongation


Translation elongation3

Polypeptide

Ala

Met

Phe

Leu

Ser

Arg

Aminoacyl tRNA

Gly

P

A

CGA

Ribosome

E

CCA

UCU

5’

GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA

3’

mRNA

Translation - Elongation


Translation elongation4

Polypeptide

Met

Phe

Leu

Ser

Arg

Ala

Gly

P

A

Ribosome

E

CCA

CGA

UCU

5’

GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA

3’

mRNA

Translation - Elongation

http://highered.mcgraw-hill.com/sites/0072943696/student_view0/chapter3/animation__protein_synthesis__quiz_3_.html

http://www.youtube.com/watch?v=nl8pSlonmA0&feature=related


Mutation

Mutation

  • A change in the nitrogenous base sequence of DNA; that change can cause a change in the product coded for by the mutated gene.

  • Neutral

  • Hazardous

  • Beneficial


Mutations

Mutations

What happens when you get insertions or deletions of bases in the DNA sequence?

Usually you end up with a mess.

THE BIG FAT CAT ATE THE RAT AND GOT ILL

Deletion of one base

THE IGF ATC ATA TET HER ATA NDG OTI LL

And its all pops and buzzes!!


Introduction the central dogma of molecular biology

  • Base Substitution

    - One base pair in DNA is replaced with a different base pair (point mutation)

  • Deletion

    - A piece of DNA breaks off and is lost

  • Duplication and Translocation

    - A piece of DNA breaks off and is incorporated into another strand of DNA

  • Frameshift

    - Deletion or Addition results in a shift in the DNA frame

  • Silent mutation

    - codon is changed, but still codes for the same amino acid: serine codons – TCT, TCG, TCA, and TCC


Mutations1

mutations

  • http://www.hhmi.org/biointeractive/dna/DNAi_damage_mutation.html

  • http://www.hhmi.org/biointeractive/dna/DNAi_sicklecell.html


  • Login