1 / 27

Mycolic Acid Synthesis in Rhodococcus

Mycolic Acid Synthesis in Rhodococcus. Investigation of the Rhodococcus sp. I24 homologue of the Mycobacterium tuberculosis Gene mmaA3. Kelsey Byers and Jennifer Hogan 22 Nov 2005 7.13 – Project Lab. Reminder: What is mmaA3 ?. Gene in Mycobacterium tuberculosis

summer
Download Presentation

Mycolic Acid Synthesis in Rhodococcus

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Mycolic Acid Synthesis in Rhodococcus Investigation of the Rhodococcus sp. I24 homologue of the Mycobacteriumtuberculosis Gene mmaA3 Kelsey Byers and Jennifer Hogan 22 Nov 2005 7.13 – Project Lab

  2. Reminder: What is mmaA3 ? • Gene in Mycobacterium tuberculosis • Involved in mycolic acid* synthesis • MmaA3 O-methylates hydroxyl groups • Requires MmaA4 for activity • *Overexpression -> more methoxy-. less keto-MAs Protein structure of mmaA2, a close relative of mmaA3 (83% positive similarity) (source: Pfam, http://www.sanger.ac.co.uk/Software/Pfam)

  3. Strains and Plasmids - Overview • Study strain: Rhodococcus sp. I24 • not fully characterized • seems to exhibit cording* • Study plasmid: pAL349 • “suicide vector” • AmpR, GentR • Replicates in Escherichia coli S17-1, not in Rhodococcus sp. I24 pAL349 vector feature/restriction map (drawn by Kelsey Byers using xfig)

  4. PCR

  5. Identify A Gene • Candidate genes taken from Mycobacterium tuberculosis • mmaA3 • Controls O-methylation of hydroxymycolate precursors to methoxymycolic acids • In M. tuberculosis, lack of mmaA3 results in disruption of mycolic acids production of methoxymycolic acids.

  6. BLAST • Searched Rhodococcus sp. I24 genome for a homologue • Result was 276 base pairs with a 69% match and a score of 313 bits.

  7. PCR

  8. PCR

  9. Primers and PCR • Designed primers that correspond to a region in the middle of the gene • Added Restriction sites on either end • Performed PRC with HotStar Taq GCAAGCTTACTACGACGTGAACACGATCGGGCTCACGCTCAGCCGCAACCAGTACGAGCACGTCCGCGACCTCGCAGCGGGGCTGCCCGGCCCCCGCACCGTGGACGTGCGGCTGCAGGGCTGGGAGGAGTTCGACGGGCGCGTGGACCGCATCGTGAGCATCGGCGCGTTCGAGCACTTCCGGAGCGAACGCTACGACCGGTTCTTCACCAAGTGCCACGACATGCTGCCCCCGGACGGCCGGATGCTGCTGCACACCATCGTGGGGCACCGCCTCGCGACGCTGCGCGAGCGGGGAATCCCGGTGACCCGGGAGAACGCGCTGTTCCACATCTTCATCAAGCGCGAGATCTTCCCCGGCGGGCAGTTGCCGCAGCCGGAGACGGTGGTCGACGGCGCGGAGCGGGCGGGGTTCCGGGTCGAACGCATCCAGGCCCTGGCGCCGCACTACGTCCGCACCCTCGAAATCGATGC

  10. PCR

  11. Ligation into pCR2.1-TOPO • Ligation into pCR2.1-TOPO to create pCR2.1-TOPO-mmaA3 • Insterted between HindIII and ClaI sites

  12. Transformed into E. coli • Transformed the pCR2.1-TOPO-mmaA3 into the provided chemically competent One-Shot E. coli cells • Selected with Ampicillin

  13. Verify Transformation Candidates • Verified tranformation candidates with a PstI digest • Lane 2 - PstI cleaves pCR2.1-TOPO twice and our insert once • Lane 3 – HindIII cuts our digest once • Lane 4 – EcoRI cuts pCR2.1-TOPO once • Lane 5 – ClaI cuts our insert once

  14. Sequenced pCR2.1-TOPO-mmaA3 • Sequenced the pCR2.1-TOPO-mmaA3 plasmid • The actual sequence matched the predicted sequence 100% and was in the correct orientation

  15. PCR

  16. Ligation into pAL349 • Insert was removed from the pCR2.1-TOPO-mmaA3 via double digest of HindIII and ClaI • pAL349 also digested with HindIII and ClaI • Gel purification of digested insert and pAL394 • Ligated mmaA3 and pAL349 • pAL349 is a suicide vector

  17. PCR

  18. Transformation into E. coli • Transforming into chemically competent E. coli S17-1 • It will take up the pAL349-mmaA3 plasmid

  19. Verify Transformation Candidates • Transformation candidates will be verified with a restriction enzyme digests of PstI, SmaI, and KpnI • Candidates that show the correct bands for these digests will be sent out for sequencing

  20. PCR

  21. Mating E. coli and Rhodococcus sp. I24 • We will mate E. coli S17-1 and Rhodococcus sp. I24 • This will transfer the pAL349-mmaA3 plasmid to Rhodococcus sp. I24 • Rhodococci with the plasmid will be selected through Gentamicin resistance conveyed by the plasmid Bacteria mating with a mamallian cell. Stanhope, M. J. et al. (2001) Phylogenetic analyses do not support horizontal gene transfers from bacteria to vertebrates. Nature411, 940 - 944

  22. PCR

  23. Macroscopic Observation of Cording • M. tuberculosis lacking mmaA3 and closely related genes show a phenomenon called cording • Will observe to see if the Rhodococcus sp. I24 lacking the mmaA3 homologue also shows cording Macro- and microscopic morphology. Left to right: wild-type, pcaA deletion, pcaA deletion rescued by pcaA. Top is BCG, bottom is M. tuberculosis. From Glickman et al. 2000, Figures 1 and 2.

  24. Thin Layer Chromotography (TLC) • Prepare a TLC plate (glass, metal, or plastic coated with adsorbent) • Spot material of interest (in solution) on bottom • Place plate in solvent container • Solvent is the liquid phase, which migrates upwards along with the material of interest via capillary action • Visualize using color (for colored compounds) or UV (plate contains UV-fluoresent-material) Diagram of TLC tank drawn by Theresa Knott. Used under GNU Free Document Lisence 1.2 http://upload.wikimedia.org/wikipedia/en/8/8a/Cromatography_tank.png

  25. Thin Layer Chromotography (TLC) • TLC is able to separate the kids of mycolic acids from a purified sample of lysed bacteria • We will use TLC to see if there is any difference in the kind and amount of mycolic acid synthesised by the mmaA3 homologue knockouts

  26. Normal lab safety concerns always apply – UV, heat, etc. Four most hazardous chemicals: Ethidium bromide: mutagen, used in gels Phenol/Chloroform/Isoamyl alcohol: toxic, in gDNA prep Rhodamine B: carcinogen, used in TLC Hexanes: extremely flammable, nerve agent, used in TLC Steps taken to reduce risk Aggressive use of PPE Always wear nitrile gloves Goggles and hot gloves when appropriate Work in fume hood for all Proper disposal of hazardous waste Carried out weekly by EHS as per standards Stored properly in SAA Safety Concerns

  27. References • Barry et al. (1998). “Mycolic acids: structure, biosynthesis, and physiological functions.” Prog. Lipid Res. 37(3): 143-79. • Nishiuchi, Baba, and Yano (1999). “Mycolic acids from Rhodococcus, Gordonia, and Dietzia.” J. Microbiol. Methods 40: 1-9. • Sutcliffe (1998). “Cell envelope composition and organisation in the genus Rhodococcus.” Antonie van Leeuwenhoek 74: 49-58. • Takayama, Wang, and Besra (2005). “Pathway to synthesis and processing of mycolic acids in Mycobacterium tuberculosis.” Clin. Microbiol. Rev. 18(1): 81-101. • Glickman, Cox, and Jacobs (2000). “A novel mycolic acid cyclopropane synthetase is required for cording, persistence, and virulence of Mycobacterium tuberculosis.” Molecular Cell 5(4): 717-27. • Yuan, Zhu, Crane, Barry. (1998) The effect of oxygenated mycolic acid composition on cell wall function and macrophage growth in Mycobacterium tuberculosis. Molecular Microbiology 29(6), 1449-1458 • Marcel Behr, Benjamin G Schroeder, Jacquelyn N Brinkman. (2000) A Point Muatation in the mma3 Gene Is Responsible for Impared Methoxymycolic Acid Production in Mycobacterium bovis BCG Strains Obtained after 1927; Journal of Bacteriology, 182(12), 3394-3399

More Related