1 / 41

Computational Molecular Biology Biochem 218 – BioMedical Informatics 231 http://biochem218.stanford.edu/

Computational Molecular Biology Biochem 218 – BioMedical Informatics 231 http://biochem218.stanford.edu/. Simple Nucleotide Polymorphisms (SNPs). Doug Brutlag Professor Emeritus Biochemistry & Medicine (by courtesy). Frequency of SNPs in the Human Genome. S imple. mutations.

sumi
Download Presentation

Computational Molecular Biology Biochem 218 – BioMedical Informatics 231 http://biochem218.stanford.edu/

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Computational Molecular BiologyBiochem 218 – BioMedical Informatics 231http://biochem218.stanford.edu/ Simple Nucleotide Polymorphisms (SNPs) Doug Brutlag Professor Emeritus Biochemistry & Medicine (by courtesy)

  2. Frequency of SNPs in the Human Genome Simple mutations

  3. SNPs & InDels in HuRef Autosomes

  4. 2007 Scientific Breakthrough of the Year Individual 1 Individual 2 Individual 3 Individual 4

  5. Single (Simple) Nucleotide Polymorphisms (SNPs) • SNPs are used for identification and forensics • SNPs are used for mapping and genome-wide association studies of complex diseases • SNPs are used for estimating predisposition to disease • SNPs are used for immigration & citizenship in the UK • SNPs are used to predict specific genetic traits • SNPs are used for classifying patients in clinical trials GCTGTATGACTAGAAGATCGAT GCTGTATGACGAGAAGATCGAT

  6. Orchid Cellmark Ltd.http://www.cellmark.co.uk/

  7. A SNP Primer at NCBIhttp://www.ncbi.nlm.nih.gov/About/primer/snps.html

  8. Department of Energy (DOE) SNP Pagehttp://www.ornl.gov/sci/techresources/Human_Genome/faq/snps.shtml

  9. Simple Nucleotide Polymorphisms (SNPs) • Most SNPs are genetically neutral • Forensics • Paternity tests • Immigration in the United Kingdom • Follow ethnic migrations • Clinical trials • However SNPs can reflect distinguishing characteristics • Predisposition to disease • Insurability and employment => GINA, December 7, 2009 • Often the basis for discrimination or other stigma • Some variations cause disease. Unlike SNPs, these variations are usually very rare. • SNPs can serve as genetic markers for other traits • Clinical trials associate SNPs with drug efficacy • Clinical trials associate SNPs adverse drug reactions • Consumer genomics associate SNPs with many other traits • 23andMe, Navigenics, DNADirect

  10. Carrier Frequency of Cystic Fibrosis Alleleshttp://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=gene&part=cf

  11. Carrier Frequency of Gaucher’s Alleleshttp://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=gene&part=gaucher

  12. Eric Green’s View of SNPs(Director of NHGRI)

  13. Eric Green’s View of SNPs(Director of NHGRI)

  14. Types of SNPshttp://www.ncbi.nlm.nih.gov/sites/entrez?db=snp • Noncoding SNPs • 5’ UTR • 3’ UTR • Introns • Intergenic Regions • Pseudogenes • Regulatory • Splicing • Transcriptional regulation (promoter & TF binding sites) • Translational regulation (initiation or termination) • Regulatory miRNA target sites • Coding SNPs • Synonymous SNPs (third position variation) • Replacement SNPs (change Amino acid) • Functional SNPs (acceptable amino acid replacement) • Non-functional SNPs (traits & diseases)

  15. Human Promoter SNPs © Gibson & Muse, A Primer of Genome Science

  16. Human Beta Hemoglobin Genehttp://www.ncbi.nlm.nih.gov/gene/3043?ordinalpos=3&itool=EntrezSystem2.PEntrez.Gene.Gene_ResultsPanel.Gene_RVDocSum

  17. Human Beta Hemoglobin Gene SNPs

  18. Beta-hemoglobin GeneView in dbSNP

  19. One β-Hemoglobin SNP

  20. GeneView of One β-Hemoglobin SNP

  21. Diversity of One β-Hemoglobin SNP

  22. SNP Variation Viewer

  23. OMIM SNP Variations

  24. dbSNP at NCBIhttp://www.ncbi.nlm.nih.gov/SNP/

  25. Origin of Haplotypes © Gibson & Muse, A Primer of Genome Science

  26. Linkage Disequilibrium and Recombination Rate © Gibson & Muse, A Primer of Genome Science

  27. Linkage Disequilibrium (LD) Across the Human LPL Gene © Gibson & Muse, A Primer of Genome Science

  28. Recombination hotspots are widespreadand account for LD structure 7q21 © Gibson & Muse, A Primer of Genome Science

  29. Recombination hotspots are widespreadand account for LD structure 7q21 © Gibson & Muse, A Primer of Genome Science

  30. Observation of Haplotypes Individual 1 Individual 2 Individual 3 Individual 4 © Gibson & Muse, A Primer of Genome Science

  31. SNPs in Populations © Gibson & Muse, A Primer of Genome Science

  32. Sequence and Distance-Based Phylogenies (evolutionary trees) • Sequence-Based Methods (Parsimony) • Assigns mutations to branches • Minimize number of changes • Topology maximizes similarity of neighboring leaves • Distance-based methods • Branch lengths = D(i,j)/2 for sequences i, j • Distances must be metric • Distances can reflect time or number of changes • Distances must be relatively constant per unit branch length

  33. © Francis Collins, 2008

  34. International HapMap Projecthttp://www.hapmap.org/

  35. International HapMap Projecthttp://www.hapmap.org/

  36. International HapMap Projecthttp://www.hapmap.org/

  37. International HapMap Projecthttp://www.hapmap.org/

  38. International HapMap Projecthttp://www.hapmap.org/

  39. Thousand Genomes Organizationhttp://www.1000genomes.org/

  40. Thousand Genomes Organizationhttp://www.1000genomes.org/

  41. 10,000 Genomes Project Evolutionary Biologyhttp://www.genome.gov/

More Related