Cieto riekstu vācelīte
This presentation is the property of its rightful owner.
Sponsored Links
1 / 12

Cieto riekstu vācelīte PowerPoint PPT Presentation


  • 57 Views
  • Uploaded on
  • Presentation posted in: General

Cieto riekstu vācelīte. Jānis Liepiņš. 11/12/2004. 1. Sakārtojiet kreisās kolonnas lielumus ar tiem atbilstošajām otrās kolonnas vērtībām. a) 10 -3 m. 1nm. 2 mm. b) 10 3 m. 3 cm. c) 10 -6 m. 4 km. d) 10 -12 m. e) 10 -2 m. 5 m m. f) 10 -9 m. 6 pm. 2.

Download Presentation

Cieto riekstu vācelīte

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Cieto riekstu v cel te

Cieto riekstu vācelīte

Jānis Liepiņš

11/12/2004


Cieto riekstu v cel te

1

Sakārtojiet kreisās kolonnas lielumus

ar tiem atbilstošajām otrās kolonnas

vērtībām

a) 10-3 m

1nm

2 mm

b) 103 m

3 cm

c) 10-6 m

4 km

d) 10-12 m

e) 10-2 m

5 mm

f) 10-9 m

6 pm


Cieto riekstu v cel te

2

OD (Optical Density) ir lielums, kas

raksturo dotā šķīduma "caurspīdīgumu",

pēc kā savukārt var spriest par tajā

suspendēto vielu/daļiņu koncentrāciju.

OD600 izmanto šūnu kultūras blīvuma mērīšanai.

OD600 atkarība no šūnu skaita ml ir lineāra

(grafiks taisne);

OD600= 0 atbilst izejas šķīdumam bez šūnām, OD600=1 šūnu skaits/ml =106/ml


Cieto riekstu v cel te

2

OD (Optical Density) ir lielums,

kas raksturo dotā šķīduma "caurspīdīgumu",

pēc kā savukārt var spriest par tajā

suspendēto vielu/daļiņu koncentrāciju.

OD600 izmanto šūnu kultūras blīvuma mērīšanai.

OD600 atkarība no šūnu skaita ml ir lineāra

(grafiks taisne);

OD600= 0 atbilst izejas šķīdumam bez šūnām,

OD600=1 šūnu skaits/ml =106/ml

Cik šūnu ir 100 ml šūnu suspensijas, ja nomērītais OD600= 0,21 ?


Cieto riekstu v cel te

3

Lai uzsētu biezu (liels OD600) suspensiju uz

barotnēm un varētu atlasīt atsevišķas

šūnas lieto atšķaidījumu metodi.

Atšķaida izejas kultūru 10 reižu,

to vēlreiz 10x, to atkal utt....

Tādā veidā iegūtos atšķaidījumus sauc par

pirmo, otro, 3-o...utt atšķaidījumiem.


Cieto riekstu v cel te

3

Lai uzsētu biezu (liels OD600) suspensiju uz

barotnēm un varētu atlasīt atsevišķas šūnas

lieto atšķaidījumu metodi.

Atšķaida izejas kultūru 10 reižu,

to vēlreiz 10x, to atkal utt....

Tādā veidā iegūtos atšķaidījumus sauc par

pirmo, otro, 3-o...utt atšķaidījumiem.

Cik kolonijas iegūst uz plates (teorētiski jāizaug) no 100 ml 5-tā atšķaidījuma

(izejas kultūras OD600=5).

Pieņem, ka viena kolonija

veidojas no vienas šūnas.


Cieto riekstu v cel te

4

Izdzīvotība ir lielums, kas raksturo

dzīvo indivīdu īpatsvaru populācijā,

apzīmē SR (Survival Rate),

aprēķina SR=nlive/nS, kur

nlive – dzīvo īpatņu skaits,

nS – kopējais īpatņu skaits

Parasti SR izsaka procentos


Cieto riekstu v cel te

4

Izdzīvotība ir lielums, kas raksturo

dzīvo indivīdu īpatsvaru populācijā,

apzīmē SR (Survival Rate),

aprēķinaSR=nlive/nS, kur

nlive – dzīvo īpatņu skaits,

nS – kopējais īpatņu skaits

Uzsējot 100 ml šūnu kultūras ar OD600=4,

4-o atšķaidījumu, izauga 30 kolonijas.

Kāda ir šūnu kultūras izdzīvotība?

Pieņem, ka viena kolonija veidojas

no vienas dzīvās šūnas.


Cieto riekstu v cel te

5 cm

B

A

5

Kādā palielinājumā

redzami dotie objekti?

Kas ir apzīmēts

ar A un B?


Cieto riekstu v cel te

6

Homoloģija (H) ir lielums, kas raksturo

cik līdzīgas ir dotās DNS, RNS, proteīnu

u.c sekvences. Sekvenču homoloģija ir

relatīvs lielums, parasti to izsaka %

Aprēķina: H = nsim/nS, kur

nsim = vienādo atbilstošo elementu skaits

(elementi atrodas vienādās pozīcijās)

nS = kopējais fragmenta garums

(elementu skaits virknē)


Cieto riekstu v cel te

6

Aprēķina: H = nsim/nS, kur

nsim = vienādo atbilstošo elementu skaits

(elementi atrodas vienādās pozīcijās)

nS = kopējais fragmenta garums

(elementu skaits virknē)

Kāda ir doto DNS sekvenču homoloģija:

Seq1

tgagtcctttgggattgtccactcctgatg

Seq2

cgagtcctttgggactgtcctctgcaaatg


Cieto riekstu v cel te

Drīz sekos atbildes!


  • Login