Transcription
This presentation is the property of its rightful owner.
Sponsored Links
1 / 23

Transcription PowerPoint PPT Presentation


  • 83 Views
  • Uploaded on
  • Presentation posted in: General

Transcription. Gene 2. DNA molecule. Gene 1. Gene 3. DNA strand (template). 5. 3. A. C. C. T. A. A. A. C. C. G. A. G. TRANSCRIPTION. A. U. C. G. C. U. G. G. G. U. U. U. 5. mRNA. 3. Codon. TRANSLATION. Gly. Phe. Protein. Trp. Ser. Figure 17.4.

Download Presentation

Transcription

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Transcription

Transcription


Transcription

Gene 2

DNA

molecule

Gene 1

Gene 3

DNA strand

(template)

5

3

A

C

C

T

A

A

A

C

C

G

A

G

TRANSCRIPTION

A

U

C

G

C

U

G

G

G

U

U

U

5

mRNA

3

Codon

TRANSLATION

Gly

Phe

Protein

Trp

Ser

Figure 17.4

Amino acid


Transcription

Second mRNA base

U

C

A

G

U

UAU

UUU

UCU

UGU

Tyr

Cys

Phe

UAC

UUC

UCC

UGC

C

U

Ser

UUA

UCA

UAA

Stop

Stop

UGA

A

Leu

UAG

UUG

UCG

Stop

UGG

Trp

G

CUU

CCU

U

CAU

CGU

His

CUC

CCC

CAC

CGC

C

C

Arg

Pro

Leu

CUA

CCA

CAA

CGA

A

Gln

CUG

CCG

CAG

CGG

G

Third mRNA base (3 end)

First mRNA base (5 end)

U

AUU

ACU

AAU

AGU

Asn

Ser

C

lle

AUC

ACC

AAC

AGC

A

Thr

A

AUA

ACA

AAA

AGA

Lys

Arg

Met or

start

G

AUG

ACG

AAG

AGG

U

GUU

GCU

GAU

GGU

Asp

C

GUC

GCC

GAC

GGC

G

Val

Ala

Gly

GUA

GCA

GAA

GGA

A

Glu

Figure 17.5

GUG

GCG

GAG

GGG

G

  • A codon in messenger RNA

    • Is either translated into an amino acid or serves as a translational start or stop signal


Transcription

  • The following is the sequence of a bases on the template strand of DNA in the transcription unit

    3’ – GGATCAGGTCCAGGCAATTTAGCATGCCCC – 5’

    • Transcribe this sequence into mRNA

    • List the order of amino acids


Four major steps

Four Major Steps

  • Initiation

  • Elongation

  • Termination

  • Posttranscriptional Modification


Parts of a gene

Parts of a Gene

  • promoter - DNA sequences which indicate the location of a gene

  • promoters are located upstream from the DNA region that contains the information to be transcribed into mRNA

gene

promoter

transcription region

termination sequence


Orientation about a gene

Orientation About a Gene

upstream

downstream

  • RNA polymerase – transcription enzyme (synthesizes mRNA in 5’  3’ direction)

  • uses upstream, promoter region to determine where to start mRNA transcription

0

negative numbers

positive numbers

start transcription


Initiation

Initiation

  • dsDNA (double stranded DNA) needs to be opened for mRNA to be made

  • promoter regions are often sequences of A’s and T’s

    • 2 H-bonds between A&T

    • easier to break than 3 H-bonds between G&C

    • prokaryotic genes have a TATA box

  • RNA polymerase opens the dsDNA


Initiation1

Eukaryotic promoters

1

TRANSCRIPTION

DNA

Pre-mRNA

RNA PROCESSING

mRNA

Ribosome

TRANSLATION

Polypeptide

Promoter

5

3

A

T

A

T

A

A

A

A

T

A

T

T

T

T

3

5

TATA box

Start point

Template

DNA strand

Several transcription

factors

2

Transcription

factors

5

3

3

5

Additional transcription

factors

3

RNA polymerase II

Transcription factors

3

5

5

3

5

RNA transcript

Figure 17.8

Transcription initiation complex

Initiation

  • transcription factors - numerous protein factors are involved in starting transcription

  • some of these proteins help control how often genes are transcribed


Elongation

Non-template

strand of DNA

Elongation

RNA nucleotides

RNA

polymerase

T

A

C

C

A

T

A

C

T

3

G

3 end

T

G

A

U

G

G

A

C

C

C

A

U

C

A

5

A

A

T

A

G

G

T

T

Direction of transcription

(“downstream”)

5

Template

strand of DNA

Newly made

RNA

Elongation

  • RNA polymerase synthesizes mRNA in the 5’  3’ direction

    • no primer is necessary

  • template strand - only one strand of the DNA is transcribed


Elongation nomenclature

Elongation Nomenclature

  • the template strand is copied into mRNA strand also known as the antisense strand

5’ A T T A C G A T C T G C A C A A G A T C C T 3’

DNA

3’ T A A T G C T A G A C G T G T T C T A G G A 5’

mRNA

ANTISENSE STRAND

5’ A U U A C G A U C U G C A C A A G A U C C U 3’

SENSE STRAND


Termination

Termination

  • RNA polymerase stops transcribing once it reaches the termination sequence

    • enzyme dissociates with DNA strand and binds to another promoter sequence

  • termination sequences differ between prokaryotes and eukaryotes


Transcription1

Transcription


Transcription animation

Transcription Animation

http://www.youtube.com/watch?v=WsofH466lqk

Start watching at 1:30.


Transcription2

1

3

2

Promoter

Transcription unit

5

3

3

5

Start point

DNA

RNA polymerase

Initiation. After RNA polymerase binds to

the promoter, the DNA strands unwind, and

the polymerase initiates RNA synthesis at the

start point on the template strand.

5

3

3

5

Template strand of DNA

Unwound

DNA

RNA

transcript

Elongation. The polymerase moves downstream, unwinding the

DNA and elongating the RNA transcript 5  3 . In the wake of

transcription, the DNA strands re-form a double helix.

Rewound

RNA

5

3

3

5

3

RNA

transcript

5

Termination. Eventually, the RNA

transcript is released, and the

polymerase detaches from the DNA.

5

3

3

5

3

5

Completed RNA transcript

Figure 17.7

Transcription


Eukaryotic differences in transcription

Eukaryotic Differences in Transcription


Posttranscriptional modification

Posttranscriptional Modification

  • mRNA of eukaryotic cells need to be modified before moving into the cytoplasm

  • primary transcript – initial eukaryotic mRNA transcript, before modification

  • 5’ cap – 7-methylguanosine triphosphate

  • poly-A tail – approx. 200 adenine ribonucleotides are added at the end

  • modifications prevent cellular enzymes from breaking down mRNA before it is translated into protein


Transcript modification

Transcript Modification

primary transcript

5’

3’

5’ cap added by capping enzyme complex

mG

3’ poly-A tail added by poly-A polymerase

mG

AAAAAAA


5 cap

5’ cap


Modifications introns exons

Modifications: Introns / Exons

  • eukaryotic genes are longer than prokaryotic genes

    • we carry extra “junk” DNA

    • most of this “junk” DNA signals when and how often genes should be transcribed  regulatory DNA

  • primary transcript is longer than necessary

    • exons– RNA sequences that will be expressed; helps makes the protein

    • introns– interfering RNA sequences; need to be removed before translation


Transcript modification1

Transcript Modification

intron

exon

intron

exon

intron

exon

intron

mG

AAAAAAA

introns removed by spliceosome proteins

exon

exon

exon

mG

mRNA transcript

AAAAAAA


Spliceosome complex

3

1

2

RNA transcript (pre-mRNA)

5

Intron

Exon 1

Exon 2

Protein

Other proteins

snRNA

snRNPs

Spliceosome

5

Spliceosome

components

Cut-out

intron

mRNA

5

Exon 1

Exon 2

Spliceosome Complex

Spliceosomes are a series of small nuclear ribonucleoproteins (snRNP) that work together to remove introns.

snRNPs recognize specific sequences on the introns

  • cuts out intron sequences

  • splices exon sequences together


Classwork homework

Classwork/Homework

  • Section 5.3 – pg. 249 #1-5, 7-9


  • Login