1 / 13

Transcription

Transcription. from ______________________ language ____ _______________________ language. Transcription. Making mRNA _______________ DNA strand = ____________strand _________________ DNA strand = ________________ same sequence as RNA synthesis of complementary RNA strand

Download Presentation

Transcription

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Transcription from______________________ language____ _______________________ language

  2. Transcription • Making mRNA • _______________ DNA strand = ____________strand • _________________ DNA strand = ________________ • same sequence as RNA • synthesis of complementary RNA strand • ______________________ • enzyme • ______________________ coding strand 3 A G C A T C G T 5 A G A A A C G T T T T C A T C G A C T DNA 3 C T G A A 5 T G G C A U C G U T C unwinding 3 G T A G C A rewinding mRNA template strand RNA polymerase 5 build RNA 53

  3. Which gene is read? • _______________ region • binding site before beginning of gene • ______________ binding site • ___________________________________________________________________________________ • Enhancer region • binding site far upstream of gene • turns transcription on HIGH

  4. Transcription Factors • Initiation complex • __________________________________________ • suite of proteins which bind to DNA • hormones? • turn on or off transcription • _________________________________________

  5. RNA polymerase Matching bases of DNA & RNA A • RNA POLYMERASE: _______________________ bases on one of the DNA strands C U G A G G U C U U G C A C A U A G A C U A 5' 3' G C C A T G G T A C A G C T A G T C A T C G T A C C G T

  6. intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Eukaryotic genes have junk! • Eukaryotic genes are not continuous • __________________________ • expressed / coding DNA • _________________________ • inbetween sequence intronscome out! eukaryotic DNA

  7. intron = noncoding (inbetween) sequence exon = coding (expressed) sequence mRNA ______________ • Post-transcriptional processing • eukaryotic mRNA needs work after transcription • primary transcript = ______________ • mRNA ________________ • _________________ • make ________________________ ~10,000 bases eukaryotic DNA pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA

  8. Splicing must be accurate • No room for mistakes! • a __________________________________________________________ AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|

  9. snRNPs snRNA intron exon exon 5' 3' spliceosome 5' 3' lariat 5' 3' exon exon mature mRNA excised intron 5' 3' RNA splicing enzymes • ____________ • small nuclear RNA • proteins • ______________ • several snRNPs • ________________________________ • cut & paste gene No, not smurfs! “snurps”

  10. Alternative splicing • _____________________________________ • when is an intron not an intron… • different segments treated as exons Starting to gethard to define a gene!

  11. 3' poly-A tail 3' A A A A A mRNA 50-250 A’s 5' cap P P P 5' G More post-transcriptional processing • _________________________ on its trip from nucleus to cytoplasm • enzymes in cytoplasm attack mRNA • _______________________________ • add _____________ • add ______________ • longer tail, mRNA lasts longer: produces more protein

  12. Transcription: In three steps

  13. aa aa aa aa aa ribosome aa aa aa aa aa aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein trait

More Related