Transcription
This presentation is the property of its rightful owner.
Sponsored Links
1 / 13

Transcription PowerPoint PPT Presentation


  • 45 Views
  • Uploaded on
  • Presentation posted in: General

Transcription. from ______________________ language ____ _______________________ language. Transcription. Making mRNA _______________ DNA strand = ____________strand _________________ DNA strand = ________________ same sequence as RNA synthesis of complementary RNA strand

Download Presentation

Transcription

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Transcription

Transcription

from______________________

language____

_______________________

language


Transcription1

Transcription

  • Making mRNA

    • _______________ DNA strand = ____________strand

    • _________________ DNA strand = ________________

      • same sequence as RNA

    • synthesis of complementary RNA strand

      • ______________________

    • enzyme

      • ______________________

coding strand

3

A

G

C

A

T

C

G

T

5

A

G

A

A

A

C

G

T

T

T

T

C

A

T

C

G

A

C

T

DNA

3

C

T

G

A

A

5

T

G

G

C

A

U

C

G

U

T

C

unwinding

3

G

T

A

G

C

A

rewinding

mRNA

template strand

RNA polymerase

5

build RNA 53


Which gene is read

Which gene is read?

  • _______________ region

    • binding site before beginning of gene

    • ______________ binding site

    • ___________________________________________________________________________________

  • Enhancer region

    • binding site far upstream of gene

      • turns transcription on HIGH


Transcription factors

Transcription Factors

  • Initiation complex

    • __________________________________________

      • suite of proteins which bind to DNA

      • hormones?

      • turn on or off transcription

    • _________________________________________


Matching bases of dna rna

RNA

polymerase

Matching bases of DNA & RNA

A

  • RNA POLYMERASE: _______________________ bases on one of the DNA strands

C

U

G

A

G

G

U

C

U

U

G

C

A

C

A

U

A

G

A

C

U

A

5'

3'

G

C

C

A

T

G

G

T

A

C

A

G

C

T

A

G

T

C

A

T

C

G

T

A

C

C

G

T


Eukaryotic genes have junk

intron = noncoding (inbetween) sequence

exon = coding (expressed) sequence

Eukaryotic genes have junk!

  • Eukaryotic genes are not continuous

    • __________________________

      • expressed / coding DNA

    • _________________________

      • inbetween sequence

intronscome out!

eukaryotic DNA


Transcription

intron = noncoding (inbetween) sequence

exon = coding (expressed) sequence

mRNA ______________

  • Post-transcriptional processing

    • eukaryotic mRNA needs work after transcription

    • primary transcript = ______________

    • mRNA ________________

      • _________________

    • make ________________________

~10,000 bases

eukaryotic DNA

pre-mRNA

primary mRNA

transcript

~1,000 bases

mature mRNA

transcript

spliced mRNA


Splicing must be accurate

Splicing must be accurate

  • No room for mistakes!

    • a __________________________________________________________

AUGCGGCTATGGGUCCGAUAAGGGCCAU

AUGCGGUCCGAUAAGGGCCAU

AUG|CGG|UCC|GAU|AAG|GGC|CAU

Met|Arg|Ser|Asp|Lys|Gly|His

AUGCGGCTATGGGUCCGAUAAGGGCCAU

AUGCGGGUCCGAUAAGGGCCAU

AUG|CGG|GUC|CGA|UAA|GGG|CCA|U

Met|Arg|Val|Arg|STOP|


Rna splicing enzymes

snRNPs

snRNA

intron

exon

exon

5'

3'

spliceosome

5'

3'

lariat

5'

3'

exon

exon

mature mRNA

excised

intron

5'

3'

RNA splicing enzymes

  • ____________

    • small nuclear RNA

    • proteins

  • ______________

    • several snRNPs

    • ________________________________

      • cut & paste gene

No, not smurfs!

“snurps”


Alternative splicing

Alternative splicing

  • _____________________________________

    • when is an intron not an intron…

    • different segments treated as exons

Starting to gethard to define a gene!


More post transcriptional processing

3' poly-A tail

3'

A

A

A

A

A

mRNA

50-250 A’s

5' cap

P

P

P

5'

G

More post-transcriptional processing

  • _________________________ on its trip from nucleus to cytoplasm

    • enzymes in cytoplasm attack mRNA

      • _______________________________

      • add _____________

      • add ______________

        • longer tail, mRNA lasts longer: produces more protein


Transcription in three steps

Transcription: In three steps


From gene to protein

aa

aa

aa

aa

aa

ribosome

aa

aa

aa

aa

aa

aa

From gene to protein

nucleus

cytoplasm

transcription

translation

DNA

mRNA

protein

trait


  • Login