Transcription
Download
1 / 13

Transcription - PowerPoint PPT Presentation


  • 63 Views
  • Uploaded on

Transcription. from ______________________ language ____ _______________________ language. Transcription. Making mRNA _______________ DNA strand = ____________strand _________________ DNA strand = ________________ same sequence as RNA synthesis of complementary RNA strand

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Transcription' - sopoline-castro


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Transcription

Transcription

from______________________

language____

_______________________

language


Transcription1
Transcription

  • Making mRNA

    • _______________ DNA strand = ____________strand

    • _________________ DNA strand = ________________

      • same sequence as RNA

    • synthesis of complementary RNA strand

      • ______________________

    • enzyme

      • ______________________

coding strand

3

A

G

C

A

T

C

G

T

5

A

G

A

A

A

C

G

T

T

T

T

C

A

T

C

G

A

C

T

DNA

3

C

T

G

A

A

5

T

G

G

C

A

U

C

G

U

T

C

unwinding

3

G

T

A

G

C

A

rewinding

mRNA

template strand

RNA polymerase

5

build RNA 53


Which gene is read
Which gene is read?

  • _______________ region

    • binding site before beginning of gene

    • ______________ binding site

    • ___________________________________________________________________________________

  • Enhancer region

    • binding site far upstream of gene

      • turns transcription on HIGH


Transcription factors
Transcription Factors

  • Initiation complex

    • __________________________________________

      • suite of proteins which bind to DNA

      • hormones?

      • turn on or off transcription

    • _________________________________________


Matching bases of dna rna

RNA

polymerase

Matching bases of DNA & RNA

A

  • RNA POLYMERASE: _______________________ bases on one of the DNA strands

C

U

G

A

G

G

U

C

U

U

G

C

A

C

A

U

A

G

A

C

U

A

5'

3'

G

C

C

A

T

G

G

T

A

C

A

G

C

T

A

G

T

C

A

T

C

G

T

A

C

C

G

T


Eukaryotic genes have junk

intron = noncoding (inbetween) sequence

exon = coding (expressed) sequence

Eukaryotic genes have junk!

  • Eukaryotic genes are not continuous

    • __________________________

      • expressed / coding DNA

    • _________________________

      • inbetween sequence

intronscome out!

eukaryotic DNA


intron = noncoding (inbetween) sequence

exon = coding (expressed) sequence

mRNA ______________

  • Post-transcriptional processing

    • eukaryotic mRNA needs work after transcription

    • primary transcript = ______________

    • mRNA ________________

      • _________________

    • make ________________________

~10,000 bases

eukaryotic DNA

pre-mRNA

primary mRNA

transcript

~1,000 bases

mature mRNA

transcript

spliced mRNA


Splicing must be accurate
Splicing must be accurate

  • No room for mistakes!

    • a __________________________________________________________

AUGCGGCTATGGGUCCGAUAAGGGCCAU

AUGCGGUCCGAUAAGGGCCAU

AUG|CGG|UCC|GAU|AAG|GGC|CAU

Met|Arg|Ser|Asp|Lys|Gly|His

AUGCGGCTATGGGUCCGAUAAGGGCCAU

AUGCGGGUCCGAUAAGGGCCAU

AUG|CGG|GUC|CGA|UAA|GGG|CCA|U

Met|Arg|Val|Arg|STOP|


Rna splicing enzymes

snRNPs

snRNA

intron

exon

exon

5'

3'

spliceosome

5'

3'

lariat

5'

3'

exon

exon

mature mRNA

excised

intron

5'

3'

RNA splicing enzymes

  • ____________

    • small nuclear RNA

    • proteins

  • ______________

    • several snRNPs

    • ________________________________

      • cut & paste gene

No, not smurfs!

“snurps”


Alternative splicing
Alternative splicing

  • _____________________________________

    • when is an intron not an intron…

    • different segments treated as exons

Starting to gethard to define a gene!


More post transcriptional processing

3' poly-A tail

3'

A

A

A

A

A

mRNA

50-250 A’s

5' cap

P

P

P

5'

G

More post-transcriptional processing

  • _________________________ on its trip from nucleus to cytoplasm

    • enzymes in cytoplasm attack mRNA

      • _______________________________

      • add _____________

      • add ______________

        • longer tail, mRNA lasts longer: produces more protein



From gene to protein

aa

aa

aa

aa

aa

ribosome

aa

aa

aa

aa

aa

aa

From gene to protein

nucleus

cytoplasm

transcription

translation

DNA

mRNA

protein

trait


ad