HE site degeneracy – HE targets in genomic DNA
This presentation is the property of its rightful owner.
Sponsored Links
1 / 9

Different approaches: PowerPoint PPT Presentation


  • 79 Views
  • Uploaded on
  • Presentation posted in: General

HE site degeneracy – HE targets in genomic DNA. Different approaches: Site degeneracy data from libraries with randomized target sites (in vitro, complexity of the initial library is crucial, involves amplification of recovered sites in E. coli ).

Download Presentation

Different approaches:

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Different approaches

HE site degeneracy – HE targets in genomic DNA

  • Different approaches:

  • Site degeneracy data from libraries with randomized target sites (in vitro, complexity of the initial library is crucial, involves amplification of recovered sites in E. coli).

  • Integration of episomal double stranded DNA (e.g. AAV or NIL vectors) at DSB sites (in vivo, not likely to cover all cleavable sites but shows a distribution of cleavage/insertion sites)

  • End capture (in vitro, should detect all possible cleavage sites although it does not necessarily reflect which sites are actually cleaved in living cells)

  • ChIP-seq (in vivo, not likely to cover all cleavable sites but potentially the best means to assess HE cleavage sites in living cells)


Different approaches

End capture

Isolate genomic DNA

(Mix with homing site containing plasmid)

(De-/methylation)

Digestion with HE

Capture ends generated by the HE with biotinylated oligos

Cleavage with EcoP15I

Binding to streptavidin beads

Ligation of sequencing adapter oligos

PCR amplification of the captured sequence

(Cloning into pGEM-T Easy)

Sequencing

BLAST

Oligos


Different approaches

- 3‘

- 5‘

5‘ -

3‘ -

m-CreI end capture – BLAST results

?

Human Chr. 22

Human Chr. 5

Human Chr. 6

T

a

g

g

g

g

t

t

c

c

G

T

G

A

G

A

C

A

G

A

G

A

c

T

G

A

A

A

C

G

T

C

G

G

G

g

g

a

c

a

g

g

a

c

a

A

C

A

A

C

C

T

T

C

A

C

G

A

g

a

a

g

t

c

t

c

C.r. cp 23S rRNA

5‘ -

- 3‘

C

C

A

C

G

C

T

T

C

T

C

A

C

Exon2

Exon1

IIS

- 3‘

5‘ -

5‘ -

- 3‘

- 3‘

5‘ -

+1

+2

+3

+4

+5

+6

+7

+8

+9

-9

-8

-7

-6

-5

-4

-3

-2

-1

-11

-10

+11

+10

G

C

A

A

A

A

C

G

T

C

G

T

G

A

G

A

C

A

G

T

T

T

A

C

G

T

T

T

T

G

C

A

G

C

A

C

T

C

T

G

T

C

A

A

hits


Different approaches

ChIP-seq

Transduction with lentiviral HE expression vectors

Cell fixation

Cell lysis and sonication

ChIP

Wash, elution and crosslink reversal

Digestion of cellular protein and RNA

DNA end repair and addition of “A” bases

Ligation of sequencing adapters

PCR amplification of the sequencing library

Gel purification of the amplified library and QC

Sequencing and data analysis

Map back on genome sequence


Different approaches

ChIP-seq

  • Non integrating lentiviral expression vectors with the following characteristics:

  • EF1a promoter

  • HE ORF (I-CreI, I-CreI+, m-CreI, I-MsoI, I-MsoI+, m-MsoI)

  • mCherry as marker (alt.: Puro, MGMT)

  • 2A sequence (or IRES) links the HE and the marker ORF

  • Cell lines:

  • HT-1080

  • U-2 OS

  • primary fibroblasts

  • hematopoietic stem cells (human/dog CD34; availability?)

  • Antibodies:

  • there are no HE specific antibodies readily available. Therefore, ChIP has to rely on antibodies against existing tags (HA, myc)

  • positive control: methylated Histone H3 (e.g. trimethyl K4)

  • negative control: AB against a protein that is not associated to chromatin (e.g. GFP, mCherry?)


Different approaches

CCCCCCCTCGACCGCAAAACGTCGTGA

GACAGTTTGGTCCAGCTTGATAT

GGGGGGGAGCTGGCGTTTTGCAG

CACTCTGTCAAACCAGGTCGAACTATA

I-CreI cleavage

CCCCCCCTCGACCGCAAAACGTCGTGA

GACAGTTTGGTCCAGCTTGATAT

GGGGGGGAGCTGGCGTTTTGCAG

CACTCTGTCAAACCAGGTCGAACTATA

Annealing/ligation of linker/capture oligos

EcoP15I

<

TCATGGATCCAAGCTTCTGCAGCAGNNNN

GACAGTTTGGTCCAGCTTGATAT

Bio-AGTACCTAGGTTCGAAGACGTCGTC

CACTCTGTCAAACCAGGTCGAACTATA

<

<

CCCCCCCTCGACCGCAAAACGTCGTGA

CTGCTGCAGAAGCTTGGATCCATGA-Bio

NNNNGACGACGTCTTCGAACCTAGGTACT

GGGGGGGAGCTGGCGTTTTGCAG

<

EcoP15I

Digestion with EcoP15I

Streptavidin binding of digestion products

Annealing/ligation of adapter/linker oligos

Wash off streptavidin beads

PCR

capture rev.

TCATGGATCCAAGCTTCTGCAGCAGNNNN

GACAGTTTGGTCCAGCTTGAT

NNCTGCAGGAATTCTCAGGCTCGAGTC

Bio-AGTACCTAGGTTCGAAGACGTCGTC

CACTCTGTCAAACCAGGTCGAACTATA

GACGTCCTTAAGAGTCCGAGCTCAG

capture forw.

68bp

capture forw.

CCCCCCCTCGACCGCAAAACGTCGTGA

CTGCTGCAGAAGCTTGGATCCATGA-Bio

GACTCGAGCCTGAGAATCCCTGCAG

CTGAGCTCGGACTCTTAAGGACGTCNN

GGGGGAGCTGGCGTTTTGCAG

NNNNGACGACGTCTTCGAACCTAGGTACT

capture rev.

68bp

Cloning and sequencing

Protocol


Different approaches

m-CreI end capture – pBSCre positive control

5’ I-CreIhs

capt.forw.

pBS

capt. rev.

capt.forw.

capt. rev.

3’ I-CreIhs

pBS


Different approaches

m-CreI end capture – BLAST results

2/4/2 (5’): 5’-CCACGCTTCTCAC-3’

2/4/4 (5’): 5’-TGAAACGTCGGGggacaggacc-3’

2/4/5 (5’): 5’-ACAACCTTCACGAgaagtctca-3’

2/4/6 (3’): 5’-aggggttccGTGAGACAGAGAT-3’

I-CreI site: 5’-caaaacgtcgtgagacagtttg-3’

2/4/2: no hits, sequence too short.

2/4/4: six hits on chromosome 22 (95-99% identity):

ref|NT_011520.11|Hs22_11677 Homo sapiens chromosome 22 genomi... 435 2e-119

ref|NW_001838745.1|Hs22_WGA1304_36 Homo sapiens chromosome 22... 429 1e-117

ref|NW_927628.1|HsCraAADB02_665 Homo sapiens chromosome 22 ge... 429 1e-117

ref|NT_011519.10|Hs22_11676 Homo sapiens chromosome 22 genomi... 407 5e-111

ref|NW_001838740.2|Hs22_WGA1299_36 Homo sapiens chromosome 22... 392 1e-106

ref|NW_921371.1|HsCraAADB02_1017 Homo sapiens genomic contig,... 387 7e-105

2/4/5: three hits on chromosome 6 (97% identity):

ref|NT_007592.14|Hs6_7749 Homo sapiens chromosome 6 genomic c... 1184 0.0

ref|NW_001838973.1|Hs6_WGA366_36 Homo sapiens chromosome 6 ge... 1184 0.0

ref|NW_922984.1|HsCraAADB02_247 Homo sapiens chromosome 6 gen... 1184 0.0

2/4/6: three hits on chromosome 5 (100% identity):

ref|NT_006576.15|Hs5_6733 Homo sapiens chromosome 5 genomic c... 348 4e-93

ref|NW_001838924.2|Hs5_WGA317_36 Homo sapiens chromosome 5 ge... 348 4e-93

ref|NW_922518.1|HsCraAADB02_205 Homo sapiens chromosome 5 gen... 348 4e-93

sites


  • Login