Primer S2
Download
1 / 1

- cloned from the anterior horn tissues - PowerPoint PPT Presentation


  • 67 Views
  • Uploaded on

Primer S2. (A). (B). AGAAGCTGGAAGAGTCAAAG GACACATTCTCCCCTCAAGC CCCAGTGGGA. AGAAGCTGGAAGAGTCAAAG GACACATTCTCCCCTCAAGC CCCAGTGGGA. Breast (C).

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' - cloned from the anterior horn tissues' - siran


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

Primer S2

(A)

(B)

AGAAGCTGGAAGAGTCAAAGGACACATTCTCCCCTCAAGCCCCAGTGGGA

AGAAGCTGGAAGAGTCAAAGGACACATTCTCCCCTCAAGCCCCAGTGGGA

Breast (C)

CCCCACAAAA GATATGTTCA TGTCCTAATC CCCAGAATCT GCAAATGTTA TTTGGAAAAA GGGGTTTTGC AGATGTAATT AAGTTAAGAA TCTTGAGATAAGATCATCCT GGATTATCCA GGTAGCCTCA AAATCAAGTG ACAAGTGTCT TTGTAAGGGA CAAGTAGACC CATTACAGAG AAGACGACGC GCAGAAAAGG AGGAAGCAGT GTGCTCATGG AGGCGGAGAT TGGAGTGATG TAACCGCAAG CCGAGGAATG CTTATAGTCA CCAGAAGCTG GAAGAGTCAA AGGACACATT CTCCCCTCAA GCCCCAGTGG GAGCACGGCC CAGCTGGATT TTGGACTTCT GGCCTCCAGA ACTGTAAGAG AAATGTCCAT TGTCTTAAGC CAACCAGTTT GTGGTAGTTT GTTACAGCAG CCCCAGGAAA CTACTA .

Breast (N)

GCACGGCCCAGCTGGATTTTGGACTTCTGGCCTCCAGAACTAGACAGGGC

Marker

GATA-1

GCACGGCCCAGCTGGATTTTGGACTTCTGGCCTCCAGAACTAGACAGGGC

Reverse

CTCACTGTGTCACCCAGGGTGGAATACAGTGGTGTGATCATAGCTCACTG

CTCACTGTGTCACCCAGGGTGGAATACAGTGGTGTGATCATAGCTCACTG

GATA-2

AluJ element

Cos7

HCT116

CAGCCTGGAATTCCTGGGCTCAAGCAACCCTGCCACCTCAGCCTTCCAAG

CAGCCTGGAATTCCTGGGCTCAAGCAACCCTGCCACCTCAGCCTTCCAAG

Forward

Nkx2-5

Nkx2-5

1

556 bp

TAGCTAGGACTACAGAACATCCATGATAGCAGTCTTCTGTAAATCGAACT

TAGCTAGGACTACAGAACATCCATGATAGCAGTCTTCTGTAAATCGAACT

2

430 bp

3

315 bp

TTTCAAGAATTCTCTGAAGGAACCAAGTAGGATATTCTTACATCATGACT

Reverse

TTTCAAGAATTCTCTGAAGGAACCAAGTAGGATATTCTTACATCATGACT

Whn

ELF-1

G

I

I

M

E

E

E

Q

K

Y

N

Q

S

F

TAATGTGAATGCAAGAACAAGAAATAGGTTTTATCTCTAAATATAATGAA

(C)

TAATGTGAATGCAAGAACAAGAAATAGGTTTTATCTCTAAATATAATGAA

+1 TRANSCRIPTION START SITE

P

I

D

G

T

S

I

V

N

L

V

S

L

L

T

C

D

1

2

3

11

Forward

GGGCTGTGTGTAAACACTGACCCTGTCTCAATTCTAACAAGCATTTTAGA

AluJ

MaLR

GGGCTGTGTGTAAACACTGACCCTGTCTCAATTCTAACAAGCATTTTAGA

MaLR-derived promoter

transcript (556 bp)

1)

Q

R

H

R

S

D

Q

S

S

S

L

M

D

G

L

M

CATGAGTTTACATCGGCAAATGGGTTCAGATCGAGATCTTCAGTCCTCTG

CATGAGTTTACATCGGCAAATGGGTTCAGATCGAGATCTTCAGTCCTCTG

Control

1

2

10

M

S

L

H

R

Q

M

G

S

D

R

D

L

Q

S

S

MaLR-derived promoter

transcript (430 bp)

AluJ

MaLR

2)

A

S

S

V

S

L

P

S

V

K

K

A

P

K

K

R

R

CTTCATCTGTGAGCTTGCCTTCAGTCAAAAAGGCACCCAAAAAAAGAAGA

CTTCATCTGTGAGCTTGCCTTCAGTCAAAAAGGCACCCAAAAAAAGAAGA

A

S

S

V

S

L

P

S

V

K

K

A

P

K

K

R

R

0 2 4 6 8 10 12 14 16 18 20 22

R

I

S

I

G

S

L

F

R

K

K

D

N

K

R

K

S

ATTTCAATAGGCTCCCTGTTTCGGAGGAAAAAAGATAACAAACGTAAATC

1

2

11

3

Relative Luciferase Activity

(Fold of pGL-2 control)

ATTTCAATAGGCTCCCTGTTTCGGAGGAAAAAAGATAACAAACGTAAATC

AluJ

MaLR

R

I

S

I

G

S

L

F

R

K

K

D

N

K

R

K

S

3)

R

E

L

N

G

G

V

D

G

I

A

S

I

E

S

I

AAGGGAGCTAAATGGCGGGGTGGATGGAATTGCAAGTATTGAAAGTATAC

AAGGGAGCTAAATGGCGGGGTGGATGGAATTGCAAGTATTGAAAGTATAC

R

E

L

N

G

G

V

D

G

I

A

S

I

E

S

I

115 bp

126 bp

Primer AS2

RT-PCR

Realtime

RT-PCR

Cloning &

Sequencing

Promoter

assay

Evolutionary Conservation of the Dorfin Gene

Human

100

Dog

Pig

77

100

Cattle

42

Mouse

100

Rat

100

Chicken

Zebrafish

- cloned from the anterior horn tissues

Amyotrophic lateral sclerosis

Parkinson’s disease

분류

연구

genome

genome 수준에서의 연구는

이루어지지 않았음

transcriptome

cDNA 서열결정

northern blot으로 발현패턴 확인

ALS에서의 전사체 발현양 연구

proteome

E3 activity의 확인

dorfin이 존재하는 위치확인

신경퇴행성질병과의 관련성 연구

RBRfamily의 계통연구

parkin과의 homology연구

활성메카니즘에 관련된 연구(VCP관련)

CaR의 degradation에 미치는 영향 연구

Other region

SINE

13%

16%

LINE

NM_015435.3 

20%

HERV element

8%

Gene-related

Sequence

DNA element

Pseudogene

3%

1%

36%

Coding sequence

3%

Expression and Promoter Activity of MaLR Element of Dorfin Gene

Related to Parkinson’s Disease

Abstracts

Results & Discussion

Dorfin containing RING-finger and IBR motifs is an E3 ubiquitin ligase that is localized in Lewy bodies, a characteristic neuronal inclusion in Parkinson’s disease brains.  The Dorfin gene located on human chromosome 8q22.2 has showed 4.4 kb transcript and expressed ubiquitously in various tissues.  Here we found its alternatively spliced transcript variants which derived from MaLR (mammalian LTR-retrotransposon) insertion.  The MaLR-derived promoter transcripts are detected as two different types in all tissues examined, while breast tissue only showed three variant types.  Reporter gene assay of the promoter activity of MaLR element on Dorfin gene indicated good activity in human colon carcinoma cells (HCT-116).  These findings suggest that the MaLR element acquired the role of transcriptional regulation of Dorfin gene in various human tissues during primate evolution..

Expression of Dorfin gene by cellular promoter

Skeletal muscle

Adrenal gland

Bone marrow

Cerebellum

Adult brain

Spinal cord

Fetal brain

Fetal liver

Placenta

Trachea

Prostate

Thymus

Thyroid

Marker

Marker

Kidney

Uterus

Testis

Heart

Lung

Liver

Dorfin

494 bp

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19

Gapdh

195 bp

Introduction

Expression of Dorfin gene by MaLR-derived promoter

Lung

Relative Expression

Testis

Cerebellum

Kidney

Bone marrow

In silico analysis of transcription binding sites of MaLR element

Promoter Activity of the MaLR Element

Materials & Methods

References

Sin HS, Huh JW, Kim DS, Kang DW, Min DS, Kim TH, Ha HS, Kim HH, Lee SY, Kim HS. 2006.

Transcriptional control of the HERV-H LTR element of the GSDML gene in human tissues and cancer cells.

Arch. Virol. [Epub ahead of print]

Hishikawa N, Niwa J, Doyu M, Ito T, Ishigaki S, Hashizume Y, Sobue G. 2003.

Dorfin localizes to the ubiquitylated inclusions in Parkinson's disease, dementia with Lewy bodies, multiple

system atrophy, and amyotrophic lateral sclerosis.

Am J Pathol. 163(2):609-619.

Genome Information Lab


ad