Sequencing its regions of rdna using primers 18s 26s kn58 knrv
This presentation is the property of its rightful owner.
Sponsored Links
1 / 8

SEQUENCING ITS REGIONS OF rDNA USING PRIMERS 18S & 26S KN58 & KNRV PowerPoint PPT Presentation


  • 45 Views
  • Uploaded on
  • Presentation posted in: General

SEQUENCING ITS REGIONS OF rDNA USING PRIMERS 18S & 26S KN58 & KNRV. 18S TTGATTACGTCCCTGCCCTTT 26S TTTCACTCGCCGTTACTAAGG Vrain et al. 1992 KN58 GTATGTTTGGTTGAGGGTC KNRV CACGCTCATACAACTGCTC.

Download Presentation

SEQUENCING ITS REGIONS OF rDNA USING PRIMERS 18S & 26S KN58 & KNRV

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Sequencing its regions of rdna using primers 18s 26s kn58 knrv

SEQUENCINGITS REGIONS OF rDNAUSINGPRIMERS 18S & 26S KN58 & KNRV


Sequencing its regions of rdna using primers 18s 26s kn58 knrv

18S TTGATTACGTCCCTGCCCTTT26STTTCACTCGCCGTTACTAAGGVrain et al. 1992KN58GTATGTTTGGTTGAGGGTCKNRVCACGCTCATACAACTGCTC


Sequencing its regions of rdna using primers 18s 26s kn58 knrv

SEQUENCES OF 10 SPECIESS. bicornutum18S - GTA….1016 bp….TTT - 26SS. carpocapsae18S - GTA…...987 bp….TTT - 26SS. feltiae18S - GTA…...980 bp….TTT - 26SS. glaseri18S - GTA…...988 bp….TTT - 26SS. intermedium18S - GTA…..1061 bp....TTT - 26SS. monticolum18S - GTA…….916 bp...TTT - 26SS.neocurtillae18S - GTA….....968 bp…TTT- 26SS. oregonense18S - GTA …....973 bp…TTT- 26SS. scapterisci18S - GTA…….959 bp....TTT- 26SS. sp18S - GTA…. .1022 bp…TTT- 26S


Sequencing its regions of rdna using primers 18s 26s kn58 knrv

LENGTH OF ITS15.8SITS2S. bicornutum 281 157 329S. carpocapsae279 157 301S. feltiae275 157 298S. glaseri279 157 302S. intermedium302(-142) 157 349(-34)S. monticolum264 157 244(-139)S.neocurtillae257 157 304S. oregonense267 157 297S. scapterisci247(-217) 157 307S. sp301 158 313C. elegans464 154 383


Sequencing its regions of rdna using primers 18s 26s kn58 knrv

Composition

Species A% C% G% T% AT%

S. bicornutum 26 17 23 34 60

S. carpocapsae24 17 23 35 59

S. feltiae 26 18 23 33 58

S. glaseri24 222727 51

S. intermedium 25 17 22 36 61

S. monticolum 27 17 24 32 59

S. neocurtillae28 152037 65

S. oregonense 25 19 23 32 57

S. scapterisci 25 17 23 35 61

S. sp. 25 21 25 29 54


Sequencing its regions of rdna using primers 18s 26s kn58 knrv

SIMILARITY RATIOS

L

S. feltiae 849

S.oregonense 980

S. carpocapsae 558

S. scapterisci 572

S. glaseri 1130

S. sp. 1000

S. intermedium 671

S. glaseri 1130

Similarity

90%

89%

80%

58%


Sequencing its regions of rdna using primers 18s 26s kn58 knrv

S. feltiae

90%

S. oregonense

S. glaseri

58%

S. intermedium


Sequencing its regions of rdna using primers 18s 26s kn58 knrv

S. bicornutum

769µm

S. feltiae

100

849µm

S. oregonense

980µm

S. sp.

75

1000 µm

100

S. glaseri

1130µm

S. carpocapsae

85

100

558µm

S. scapterisci

66

572 µm

100

S.neocurtillae

885µm

S. monticolum

706µm

S. intermedium

671µm


  • Login