90 likes | 196 Views
Review – Chapter 4. Chapter 4. Name three differences between plant and animal cells. A – Plant cells – cell wall, larger vacuoles, chloroplasts. Animal cells – flagellum and cilia What is the purpose of the ribosome? A – Produces proteins What is the power house of the cell?
E N D
Chapter 4 • Name three differences between plant and animal cells. A – Plant cells – cell wall, larger vacuoles, chloroplasts. Animal cells – flagellum and cilia • What is the purpose of the ribosome? A – Produces proteins • What is the power house of the cell? A – Mitochondria
Cell Parts Continued • What is the purpose of the endoplasmic reticulum? A – To transport materials within the cell. • How do proteins leave the cell? A – They are packaged in vesicles (at the end of the Golgi body) and are carried to the cell membrane. • What would happen if the nucleus of a cell was taken out? A – The cell would die.
DNA • Where is DNA found? A – The nucleus • What does DNA stand for? A – deoxyribonucleic acid • What shape does DNA take? A – Double helix • What three parts make up DNA? A – Sugar, phosphate, and bases
DNA • What does A, G, C and T stand for? A – adenine, guanine, cytosine, and thymine • What does adenine pair with? A – thymine • Most of the time, DNA exists in the nucleus in the form of what? A – chromatin • What does DNA code for? A – proteins
Chromosomes • How many pairs of chromosomes are found in human cells? A – 23 pairs • If your 23rd pair of chromosomes is XY, you would be a … A – male/boy • Small segments of DNA are called what? A - genes
Genes/Proteins • What is the importance of genes? A – stores information needed to produce specific proteins. • Which of the following are not specialized proteins: hormones, nucleolus, enzyme? A – nucleolus • Why are stomach cells different from skin cells? A – different proteins have been made for each cell.
Protein Production • What does RNA stand for? A – ribonucleic acid • How is the message for a protein to be made carried from the nucleus to the ribosomes? A – DNA message for a specific protein is copied into RNA which leaves through the nuclear pore and delivers the message to the ribosome. • What is the function of the Golgi body? A – To repackages the protein for transport out of the cell.
Mutations • What type of mutation is occurring in the following DNA sequence (and where): CATGCCTGACGTCTGATGCCA Mutation 1: CATGCCTGACCTCTGATGCCA A – Substitution – CATGCCTGACCTCTGATGCCA Mutation 2: CATGCCTGACGTCTGATGCCAA A – Addition – CATGCCTGACGTCTGATGCCAA Mutation 3: CATCCTGACGTCTGATGCCA A – Deletion - CATCCTGACGTCTGATGCCA