What is microarray
This presentation is the property of its rightful owner.
Sponsored Links
1 / 32

What Is Microarray PowerPoint PPT Presentation


  • 47 Views
  • Uploaded on
  • Presentation posted in: General

What Is Microarray. A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale. Microarray. Replication. Transcription. Translation. DNA. RNA. Protein. Reverse transcription. DNA. ATATCGGCATCAGTCGATCGATCATCGATCGAT. mRNA.

Download Presentation

What Is Microarray

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


What is microarray

What Is Microarray

  • A new powerful technology for biological exploration

    • Parallel

    • High-throughput

    • Large-scale

    • Genomic scale


Microarray

Microarray


What is microarray

Replication

Transcription

Translation

DNA

RNA

Protein

Reverse transcription

DNA

ATATCGGCATCAGTCGATCGATCATCGATCGAT

mRNA

UAUAGCCGUAGUCAGCUAGCUAGUAGCUAGCUA

cDNA

ATATCGGCATCAGTCGATCGATCATCGATCGAT


What is microarray1

What Is Microarray

  • Different Approaches


Affymetrix

Affymetrix

  • Probe Array (Photolithography)

    • Synthesis of probe

    • Hybridization


Stanford approach

Stanford Approach

  • Use robot to spot glass slides

  • Able to measure qualitatively relative expression levels of genes

    • Differential expression by use of simultaneous, two-color fluorescence hybridisation

  • Cheaper with DIY ($60,000)

  • Also called home-made system


Life cycle cont

Life Cycle(cont.)

Cy3

(green)

Cy5

(red)


Procedures

Arrayer

Hardware

Scanner

Software

Procedures

  • Preparation

    • Target DNA (reference and test samples)

    • Slides

  • Reaction(Droplet or Pin Spotting)

    • Hybridization

  • Scanning

  • Analysis

    • Image processing

    • Data mining

    • Modeling


Instruments

Instruments

  • Arrayer

  • Scanner

    • Laser Confocal Microscope


Arrayer

Arrayer


Scanner

Scanner

  • GenPix 4000


Problems by direct view

Problems – by direct view

Anti-probe Locally high background Spot overlap

Precipitate Locally low signal Comet-tails (donut hole)


Problems related wit ip

Problems –related wit IP

  • Local problems

    • Spot position variation

    • Spot shape and size irregularity

    • Spot Overlapping

  • Global problems

    • High background

    • Low signal

    • White-noise/Speckle effect (Contamination)


Array alignment

Array Alignment

Good Alignment Bad Alignment


Spot finding

Spot Finding

  • Grid System Determination

    • Manual

    • Semiautomatic

    • Automatic

  • Spot Segmentation

    • Space-based

    • Intensity-based

    • Frequency-based

    • Hybrid approach


Grid system determination

Grid System Determination


Spot segmentation

Spot Segmentation


Spot segmentation cont

Spot Segmentation(cont.)


Applications

Applications

  • Gene expression studies

    • Gene function for cell state change in various conditions

  • Disease Diagnosis

  • Pathogen Analysis


Applications cont

Applications(Cont.)

  • Drug Discovery

    • identify appropriate molecular targets for therapeutic intervention

    • monitor changes in gene expression in response to drug treatments

  • Trageted Drug Treatment


Example images e coli

Example Images – E. Coli


Example images c elegan

Example Images – C. Elegan


What is microarray

…..

Gene index

1.75

Log(R/G)

…..


What is microarray

Log(R/G)

Log(R/G)

Log(R/G)

…..

…..

…..

…..

…..

…..


What is microarray

M experiments

N gene

…..


  • Login