'Multiple alignments' presentation slideshows

What is a motif?

CZ5226: Advanced Bioinformatics Lecture 4: Motifs and methods for generating motifs Prof. Chen Yu Zong Tel: 6874-6877 Email: csccyz@nus.edu.sg http://xin.cz3.nus.edu.sg Room 07-24, level 7, SOC1, National University of Singapore. What is a motif?.

1.03k views • 72 slides

Advances and Limitations of Maximum Likelihood Phylogenetics

797 views • 64 slides

Advances and Limitations of Maximum Likelihood Phylogenetics

771 views • 64 slides

684 views • 60 slides

Robust Alignment of Drosophila Genomes Lior Pachter EECS Joint Colloquium, October 5th 2005

Robust Alignment of Drosophila Genomes Lior Pachter EECS Joint Colloquium, October 5th 2005. What is genomics?. GGGCTGGGCGAGTATCTCTTCGAAAGGCTCACTCTCAAGCACGACTAAGAGCCTTCTGAGC. GLGEYLFERLTLKHD *. What is genomics?. GGGCTGGGCGAGTATCTCTTCGAAAGGCTCACTCTCAAGCACGACTAA GAGCCTTCTGAGC.

606 views • 50 slides

Introduction to Newbler

642 views • 43 slides

Ch 5. Profile HMMs for sequence families

Ch 5. Profile HMMs for sequence families. Biological sequence analysis: Probabilistic models of proteins and nucleic acids Richard Durbin Sean R. Eddy Anders Krogh Graeme Mitchison. Contents. Components of profile HMMs HMMs from multiple alignments Searching with profile HMMs

556 views • 36 slides

T-COFFEE , a novel method for Multiple Sequence Alignments

522 views • 35 slides

489 views • 35 slides

Manually Adjusting Multiple Alignments

447 views • 33 slides

Multiple sequence alignment

Multiple sequence alignment. Conserved blocks are recognized. Different degrees of similarity are marked. Multiple Sequence Alignment. VTISCTGSSSNIGAG-NHVKWYQQLPG VTISCTGTSSNIGS--ITVNWYQQLPG LRLSCSSSGFIFSS--YAMYWVRQAPG LSLTCTVSGTSFDD--YYSTWVRQPPG

839 views • 28 slides

Wellcome Trust Workshop Working with Pathogen Genomes Module 6 Phylogeny

Wellcome Trust Workshop Working with Pathogen Genomes Module 6 Phylogeny. Phylogeny. Phylogeny refers to the ancestry of a biological lineage, but is also synonymous with phylogenetic tree Taxonomy began by grouping taxa together based on morphology at various structural levels

453 views • 24 slides

Hidden Markov Models

Hidden Markov Models. A first-order Hidden Markov Model is completely defined by: A set of states. An alphabet of symbols. A transition probability matrix T=(t ij ) An emission probability matrix E=(e iX ). Linear Architecture. Loop Architecture. Wheel Architecture. Basic Ideas.

443 views • 24 slides

Multiple sequence alignment

Multiple sequence alignment. Conserved blocks are recognized. Different degrees of similarity are marked. Multiple Sequence Alignment. VTISCTGSSSNIGAG-NHVKWYQQLPG VTISCTGTSSNIGS--ITVNWYQQLPG LRLSCSSSGFIFSS--YAMYWVRQAPG LSLTCTVSGTSFDD--YYSTWVRQPPG

358 views • 24 slides

Aligning Alignments Exactly

Aligning Alignments Exactly. By John Kececioglu, Dean Starrett CS Dept. Univ. of Arizona Appeared in 8 th ACM RECOME 2004, Presented by Jie Meng. Background Definition Hardness An Exponential time algorithm. Alignments.

345 views • 23 slides

Introduction to Bioinformatics

Introduction to Bioinformatics. Lecture 6 Substitution matrices. What to align, nucleotide or amino acid sequences?. If ORF then align at protein level (i) Many mutations within DNA are synonymous, leading to overestimation of sequence divergence if compared at the DNA level.

360 views • 22 slides

Hidden Markov Modeling, Multiple Alignments

Hidden Markov Modeling, Multiple Alignments and Structure. Bioinformatic Modeling Techniques Student: Patricia Pearl. The basic notion of a hidden Markov model was covered during the class lectures and in our midterm.

325 views • 20 slides

Hierarchical Sequencing

Hierarchical Sequencing. a BAC clone. map. Hierarchical Sequencing Strategy. Obtain a large collection of BAC clones Map them onto the genome (Physical Mapping) Select a minimum tiling path Sequence each clone in the path with shotgun Assemble Put everything together. genome.

2.84k views • 19 slides

A Hidden Markov model for progressive multiple alignment

A Hidden Markov model for progressive multiple alignment. -Ari Loytynoja and Michel C.Milinkovitch Presnted by Santosh Kumar Kodicherla. HMM Applications . Hidden Markov Model is used to find optimal value in many applications like: 1. In Membrane Helix

227 views • 13 slides

Chapter 6 - Profiles

Chapter 6 - Profiles. Assume we have a family of sequences. To search for other sequences in the family we can Search with a sequence from the family Search with more sequences from the family together Consensus sequences (regular expressions) Regular expression Ex. A-[FR]-X(2,3)-M

213 views • 10 slides