'Manatee' presentation slideshows

Tainos

7.23k views • 35 slides

Communication

425 views • 20 slides

342 views • 19 slides

Cub Scout Pack 310 2011 Adventure Sleep with the Manatees

315 views • 18 slides

Amino Acid Biosynthesis

Amino Acid Biosynthesis. By Laura Voss. Biosynthesis vs. Metabolism. Not the same as amino acid metabolism pathways. Synthesis of most amino acids is only one or two steps removed from another pathway or cycle.

359 views • 13 slides

Manatees & Dugongs

1.18k views • 11 slides

Endangered Species

Endangered Species . BRAZIL. GOLDEN LION TAMARIN.

286 views • 9 slides

My Interest

221 views • 8 slides

manatees

295 views • 7 slides

50 bp upstream of JGI/Manatee/Rast genes

50 bp upstream of JGI/Manatee/Rast genes. Finding Sequence Pattern. http://rsat.ccb.sickkids.ca /. JGI . Manatee. Rast. T T TGCGACGGACTGGATAGTGATTTGTAGGAGCGGCTCCTCTGTATACTG GGAGGTG 0 0 01000 => score= 1 T T TGCGACGGACTGGATAGTGATTTGTAGGAGCGGCTCCTCTGTATACTG GGAGGTG

179 views • 7 slides

Manatee

Manatee. Manatee. Manatee. Manatee. Manatee. Manatee.

187 views • 6 slides

6 Essential Tips for Swimming with the Manatees

http://swimmingwiththemanatees.com 6 Essential Tips for Swimming with the Manatees

36 views • 3 slides

86 views • 2 slides

Is There An Age Limit At Captain Mike's Swimming With The Manatees

http://swimmingwiththemanatees.com/ Is There An Age Limit At Captain Mike's Swimming With The Manatees

98 views • 2 slides

The Three Major Manatee Species

http://swimmingwiththemanatees.com The Three Major Manatee Species

29 views • 2 slides