'Genome research' presentation slideshows

Comparative genomics for biological discovery

1.26k views • 106 slides

Robust Alignment of Drosophila Genomes Lior Pachter EECS Joint Colloquium, October 5th 2005

Robust Alignment of Drosophila Genomes Lior Pachter EECS Joint Colloquium, October 5th 2005. What is genomics?. GGGCTGGGCGAGTATCTCTTCGAAAGGCTCACTCTCAAGCACGACTAAGAGCCTTCTGAGC. GLGEYLFERLTLKHD *. What is genomics?. GGGCTGGGCGAGTATCTCTTCGAAAGGCTCACTCTCAAGCACGACTAA GAGCCTTCTGAGC.

605 views • 50 slides

Interrogating the transcriptome in all its diversity

Interrogating the transcriptome in all its diversity. Joel H Graber. Why were so many predictions of the number of genes in a mammalian genome wrong?. Nature Genetics , June 2000, v25 , n2. Mammalian genomes contain far more transcript variants than protein variants.

565 views • 47 slides

Public Consultation and Ethics

Public Consultation and Ethics. Learning to hear the music Michael M. Burgess, Ph.D. W. Maurice Young Centre for Applied Ethics, UBC, Vancouver, Canada. Technologies, Publics and Power. Akaroa, NZ. Feb 5, 2004. What counts as ethical?. We have been made outsiders in our own world!

437 views • 29 slides

Pharmaceutical Biotechnology

Pharmaceutical Biotechnology. 4.The Drug development process. Dr. Tarek El-Bashiti Assoc. Prof. of Biotechnology. In this chapter, the life history of a successful drug will be outlined (summarized in Figure 4.1).

1.29k views • 27 slides

Integrating Genomic Databases

Integrating Genomic Databases. Chris Stoeckert, Ph.D. Computational Biology and Informatics Laboratory. Talk Outline. Challenge of integrating biological data Federations vs warehouses GUS/RAD - warehouse approach K2 - connecting to other systems. Challenge of Integrating Biological Data.

271 views • 26 slides

WP 2 Tasks: 2-1 to 2-3 Task leader: Dimitra Milioni

299 views • 16 slides

The Human Genome Project

370 views • 7 slides

Human Genome Project

Human Genome Project. Robynn Mackechnie & Valerie Meccia AP Biology 3 rd. What is the Human Genome Project (HGP)?. Created in 1990 by the: U. S. Department of Energy and National Institutes of Health.

470 views • 6 slides

Sulfolobus Tokodaii

Sulfolobus Tokodaii. A genome from Japan. By Patricia Ueng. Sulfolobus Tokodaii. A member of the archaea (third branch of life next to eukaryotes and bacteria. It was isolated from Beppu hot springs in Kyusyu, Japan It lives in 80 C and pH 2 and 3, an acidic and sulfur-rich environment.

304 views • 5 slides

Genome Editing/Genome Engineering Market, Innovation Used, End Clients, Uses, Global Analysis and Forcast 2019-2030

Genome Editing/Genome Engineering Market on a very basic level finds bits of knowledge that empower partners, entrepreneurs and field showcasing administrators to settle on viable speculation choices driven by realities u2013 as opposed to mystery. Get free PDF sample@ https://www.marketindustryreports.com/pdf/5 Get detail report @ https://www.marketindustryreports.com/5/genome-editing-genome-engineering-market

52 views • 5 slides

Genome Editing/Genome Engineering Market, Applications, Development Used, Global Analysis and Forcast 2019-2030

Genome Editing/Genome Engineering Market is driven by creative developments in the genomics, rising number of undermining improvement patients, and developing financing by government and private players in the genomics are fundamental issue driving the market. Regardless, moral issue identified with genome altering/genome building is doubtlessly going to control the market to certain degree. Get free PDF sample@ https://www.marketindustryreports.com/pdf/5 Get detail report @ https://www.marketindustryreports.com/5/genome-editing-genome-engineering-market

56 views • 5 slides

133 views • 3 slides

Research Ethics Committees in Latvia: Problems and Perspectives

Research Ethics Committees in Latvia: Problems and Perspectives.

185 views • 1 slides

SEMINAR NOTICE Department of Biotechnology

162 views • 1 slides