'Donor site' presentation slideshows

Plastic and reconstructive surgery

Plastic and reconstructive surgery. Dr Yaseen Abdullah Plastic surgeon. Learning objectives To understand The spectrum of plastic surgical techniques used to restore bodily form and function The relevant anatomy and physiology of tissues used in reconstruction

1.82k views • 59 slides

Alternative splicing: A playground of evolution

Alternative splicing: A playground of evolution. Mikhail Gelfand Institute for Information Transmission Problems, RAS. May 2004. Alternative splicing of human (and mouse) genes. Alternative splicing of orthologous human and mouse genes

656 views • 48 slides

508 views • 44 slides

CSE182-L9

584 views • 39 slides

Diagnostic microbiology lecture: 13 Gram Positive, Non Endospore-Forming Bacilli CORYNEBACTERIUM

Diagnostic microbiology lecture: 13 Gram Positive, Non Endospore-Forming Bacilli CORYNEBACTERIUM Abed ElKader Elottol MSc. Microbiology 2010. Medically Important SPECIES: 1. Corynebacterium diphtheria 2. Corynebacterium ulcerans 3. Corynebacterium ovis (pseudotuberculosis).

1.15k views • 35 slides

The Anatomy and Clinic Application of Free Medial Sural Artery Perforator Flap

714 views • 31 slides

Outline for today

Outline for today. Lec 04. Gene Prediction: What are genes ? Where are genes? Why do we care about a definition? Prokaryotic vs. eukaryotic gene models Introns/exons Splicing Alternative splicing Genes-in-genes Genes-ad-genes Multi-subunit proteins Gene identification

479 views • 27 slides

Skin Grafts and tissue flaps

Skin Grafts and tissue flaps. By Dr.Ishara Maduka M.B.B.S. (Colombo). Outline. Skin Review Definitions Difference between Grafts & Flaps Classification of Skin Grafts Types of Skin Grafts (according to depth) Indications for Grafts Donor Sites Harvesting Tools. SKIN. EPIDERMIS.

2.33k views • 25 slides

Midriff Vest

358 views • 23 slides

Burn 11 th Lecture

Burn 11 th Lecture. SKIN GRAFTS AND FLAPS TREATMENT. SKIN GRAFTS AND FLAPS TREATMENT. Definition: Skin graft: It is nonvascular skin transfers may be divided into two groups. Split-thickness skin graft. Full-thickness skin graft.

666 views • 19 slides

Presentation prepared by

Presentation prepared by . Please note: All persons shown have given their permission for their photos to be used for educational purposes. Name : Mr Bhailal Talsania Age : 54 Sex : M Diagnosis : Ca Lower Alveolus and lip and chin

656 views • 16 slides

Hyperfine Mapping of Donor Wave Function Deformations in Si:P based Quantum Devices

Hyperfine Mapping of Donor Wave Function Deformations in Si:P based Quantum Devices. Seung Hyun Park Advisors: Prof. Gerhard Klimeck Prof. Lloyd Hollenberg. Outline. Single Donor Physics - Basic single donor physics - Si:P based quantum device

281 views • 16 slides

Hydrotherapy & Burn Wound Care

2.89k views • 14 slides

Homeostatic Imbalances: Integumentary System

Homeostatic Imbalances: Integumentary System. Stretch Marks. Tearing of the reticular layer of the dermis. Bed Sores. -Person lying in same position will prevent blood flow to dermis -Consequences: Cells die and open wounds form. Rickets.

336 views • 11 slides

Best Hair Transplant Centers In Hyderabad

Dr. Raj Kirit practices at Celestee Skin and Hair Clinic in Film Nagar, Hyderabad. His experience is with all fields of dermatology ranging from Cosmetology, Dermatosurgery, Laser surgeries, Hair loss therapies, Hair transplantation and anti-aging treatments.

91 views • 8 slides

Important Questions About Hair Transplant Surgery

334 views • 7 slides

Advantages Of Choosing The Best Hair Transplant Surgeons In India

Garg Hair transplant Clinic has been awarded MOST PROMISING HAIR TRANSPLANT CENTRE IN PUNJAB. International Healthcare Award 2016 organised by Times Cyber Media and award Given by Mr. Virendra Sehwag on 27 th august 2016 - Once you have lost a considerable percentage of mop due to genetic issues or something else, such as an injury, the only remaining choice is to substitute the lost locks.

104 views • 5 slides

Advantages Of Choosing The Best Hair Transplant Surgeons In India

Garg Hair transplant Clinic has been awarded MOST PROMISING HAIR TRANSPLANT CENTRE IN PUNJAB. International Healthcare Award 2016 organised by Times Cyber Media and award Given by Mr. Virendra Sehwag on 27 th august 2016 - Once you have lost a considerable percentage of mop due to genetic issues or something else, such as an injury, the only remaining choice is to substitute the lost locks.

105 views • 5 slides

Hair Transplant cost in Indore

If you want to have hair treatment with a reasonable Hair Transplant cost in Indore and have a weak donor site, the surgeons of the clinic are going to make a treatment plan as per your needs and limitations.

41 views • 3 slides

(i) Minus-strand priming site

a. Replication. (i) Minus-strand priming site. (ii) Plus-strand primer. 4321 CGCCCGCCATTATTTTCAAACATTCCTGAAA 4329 ............................... 4327 ............................... 4329 .AAAGA..CC................A. Ph Ch Se SA. 1 TGGTATCAGAGCGATGTT 1 ..................

82 views • 1 slides