'000 genes' presentation slideshows

Computational Methods in Systems Biology

1.35k views • 103 slides

The chemical Basis of Inheritance

The chemical Basis of Inheritance. Chromatin / Chromosomes. Organism estimated size estimated gene number average gene density chromosome # Homo sapiens (human) 2900 million bases ~30,000 1 gene per 100,000 bases 46

1.04k views • 91 slides

Genomics, Bioinformatics and the Revolution in Biology

Genomics, Bioinformatics and the Revolution in Biology. Jonathan Pevsner, Ph.D. Kennedy Krieger Institute/ Johns Hopkins School of Medicine. Outline. Three views of bioinformatics and genomics Informatics From small to large From genotype to phenotype The chromosomes

1.21k views • 83 slides

Proteomics and Mass Spectroscopy

Proteomics and Mass Spectroscopy. Proteomics. The dream of having genomes completely sequenced is now a reality. The complete sequence of many genomes including the human one is known.

1.35k views • 66 slides

Differential gene expression

458 views • 34 slides

Development and Use of Controlled Vocabularies at the Arabidopsis Information Resource (TAIR)

Development and Use of Controlled Vocabularies at the Arabidopsis Information Resource (TAIR). Sue Rhee Carnegie Institution Dept. Plant Biology rhee@acoma.stanford.edu. TAIR http://arabidopsis.org. A model organism database for Arabidopsis thaliana Current major data types:

431 views • 28 slides

Development and Use of Controlled Vocabularies at the Arabidopsis Information Resource (TAIR)

Development and Use of Controlled Vocabularies at the Arabidopsis Information Resource (TAIR). Sue Rhee Carnegie Institution Dept. Plant Biology rhee@acoma.stanford.edu. TAIR http://arabidopsis.org. A model organism database for Arabidopsis thaliana Current major data types:

414 views • 28 slides

An Introduction to the Viruses

An Introduction to the Viruses. Chapter 6. Virus = (L. poison) Non-cellular infectious particles Non-living active or inactive Genetic parasites Use host cell machinery to replicate DNA or RNA. Infect all types of cells Bacteria Algae Fungi Protozoa Plants Animals.

372 views • 27 slides

Gene Prediction approaches

554 views • 26 slides

Greig cephalopolysyndactyly Polydactyly - extra digits Syndactyly - webbed digits

Genes in Development - November 5, 2000 Karen B. Avraham, Instructor. Developmental malformation syndrome. Greig cephalopolysyndactyly Polydactyly - extra digits Syndactyly - webbed digits. Mutation in GLI3 gene on chromosome 7 Zinc finger gene Cranial, hand abnormalities.

492 views • 26 slides

Honors Genetics Ms. Gaynor

Chapter 1 Introduction to Genetics. Honors Genetics Ms. Gaynor. What is Genetics?. the study of how genes act to produce the characteristics of a living organism. This course will be divided into 3 areas of study: classical genetics how traits are inherited molecular genetics

569 views • 24 slides

Next Generation Sequencing Approach to Desmoid Tumors

Next Generation Sequencing Approach to Desmoid Tumors. Matt van de Rijn. Which questions do we hope to address?. Can we distinguish aggressive desmoids from those that are indolent? Can we distinguish recurrent desmoid tumors from scars?. What do we need to know about biology?.

351 views • 20 slides

Cancer-causing genes: why do we care?

Curing Carcinoid From genes to drugs: Finding the genes Matthew Meyerson, M.D., Ph.D. Dana-Farber Cancer Institute Boston, Massachusetts.

405 views • 20 slides

338 views • 20 slides

Epidemiology 217 Molecular and Genetic Epidemiology Bioinformatics & Proteomics

519 views • 19 slides

A single strand of DNA is made of letters: ATGCTCGAATAAATGTGAATTTGA

A single strand of DNA is made of letters: ATGCTCGAATAAATGTGAATTTGA The letters make words: ATG CTC GAA TAA ATG TGA ATT TGA The words make sentences: <ATG CTC GAA TAA> <ATG TGA ATT TGA> These "sentences" are called genes. Genes tell the cell to make other molecules called proteins

621 views • 17 slides

Structural Genomics of C. elegans

Structural Genomics of C. elegans. Ming Luo, Ph.D. University of Alabama at Birmingham March 7-8, 2002, NIH. C. elegans Genome. 19,092 genes vs. Human >31,000. Outcome = speed x success rate 100 crystals = 500 purified proteins x 20%

446 views • 14 slides

IB404 - 14 - Other plants - March 10

IB404 - 14 - Other plants - March 10.

174 views • 10 slides

Mapping the Human Genome

Mapping the Human Genome. Dunnya Abdelbaqi & Miranda Jenkins. Chromosome 15. Breast Cancer (develops due to somatic mutations that occur in breast cells) Bloom Syndrome Andermann Syndrome Tyrosinemia

195 views • 7 slides

Broad Institute CCSB

Broad Institute CCSB. Todd Golub Jill Mesirov Aviv Regev Adam Margolin Michael Reich Daphne Koller Marc Vidal Bill Hahn Matthew Meyerson Levi Garraway. DANA-FARBER CANCER INSTITUTE. Overall Goal.

147 views • 3 slides